ID: 1033629453

View in Genome Browser
Species Human (GRCh38)
Location 7:143142308-143142330
Sequence AGTTTTTAAAAAAATTAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033629453_1033629460 21 Left 1033629453 7:143142308-143142330 CCTGGCTAATTTTTTTAAAAACT No data
Right 1033629460 7:143142352-143142374 GGAGCCTCACTATGTTGCCTAGG No data
1033629453_1033629455 -7 Left 1033629453 7:143142308-143142330 CCTGGCTAATTTTTTTAAAAACT No data
Right 1033629455 7:143142324-143142346 AAAAACTTTTTGTAGAGATTGGG No data
1033629453_1033629463 25 Left 1033629453 7:143142308-143142330 CCTGGCTAATTTTTTTAAAAACT No data
Right 1033629463 7:143142356-143142378 CCTCACTATGTTGCCTAGGGTGG No data
1033629453_1033629457 -2 Left 1033629453 7:143142308-143142330 CCTGGCTAATTTTTTTAAAAACT No data
Right 1033629457 7:143142329-143142351 CTTTTTGTAGAGATTGGGCAGGG No data
1033629453_1033629454 -8 Left 1033629453 7:143142308-143142330 CCTGGCTAATTTTTTTAAAAACT No data
Right 1033629454 7:143142323-143142345 TAAAAACTTTTTGTAGAGATTGG 0: 14
1: 212
2: 1345
3: 4868
4: 12615
1033629453_1033629459 0 Left 1033629453 7:143142308-143142330 CCTGGCTAATTTTTTTAAAAACT No data
Right 1033629459 7:143142331-143142353 TTTTGTAGAGATTGGGCAGGGGG No data
1033629453_1033629456 -3 Left 1033629453 7:143142308-143142330 CCTGGCTAATTTTTTTAAAAACT No data
Right 1033629456 7:143142328-143142350 ACTTTTTGTAGAGATTGGGCAGG No data
1033629453_1033629461 22 Left 1033629453 7:143142308-143142330 CCTGGCTAATTTTTTTAAAAACT No data
Right 1033629461 7:143142353-143142375 GAGCCTCACTATGTTGCCTAGGG No data
1033629453_1033629458 -1 Left 1033629453 7:143142308-143142330 CCTGGCTAATTTTTTTAAAAACT No data
Right 1033629458 7:143142330-143142352 TTTTTGTAGAGATTGGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033629453 Original CRISPR AGTTTTTAAAAAAATTAGCC AGG (reversed) Intergenic
No off target data available for this crispr