ID: 1033629454

View in Genome Browser
Species Human (GRCh38)
Location 7:143142323-143142345
Sequence TAAAAACTTTTTGTAGAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 19054
Summary {0: 14, 1: 212, 2: 1345, 3: 4868, 4: 12615}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033629452_1033629454 -3 Left 1033629452 7:143142303-143142325 CCTCACCTGGCTAATTTTTTTAA 0: 109
1: 1483
2: 30513
3: 85433
4: 176135
Right 1033629454 7:143142323-143142345 TAAAAACTTTTTGTAGAGATTGG 0: 14
1: 212
2: 1345
3: 4868
4: 12615
1033629451_1033629454 0 Left 1033629451 7:143142300-143142322 CCACCTCACCTGGCTAATTTTTT 0: 119
1: 10443
2: 56689
3: 130269
4: 193688
Right 1033629454 7:143142323-143142345 TAAAAACTTTTTGTAGAGATTGG 0: 14
1: 212
2: 1345
3: 4868
4: 12615
1033629449_1033629454 28 Left 1033629449 7:143142272-143142294 CCAGAGTAGCTGAGACTACAGGC 0: 2808
1: 83635
2: 205409
3: 240179
4: 171681
Right 1033629454 7:143142323-143142345 TAAAAACTTTTTGTAGAGATTGG 0: 14
1: 212
2: 1345
3: 4868
4: 12615
1033629453_1033629454 -8 Left 1033629453 7:143142308-143142330 CCTGGCTAATTTTTTTAAAAACT No data
Right 1033629454 7:143142323-143142345 TAAAAACTTTTTGTAGAGATTGG 0: 14
1: 212
2: 1345
3: 4868
4: 12615

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033629454 Original CRISPR TAAAAACTTTTTGTAGAGAT TGG Intergenic
Too many off-targets to display for this crispr