ID: 1033629459

View in Genome Browser
Species Human (GRCh38)
Location 7:143142331-143142353
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033629453_1033629459 0 Left 1033629453 7:143142308-143142330 CCTGGCTAATTTTTTTAAAAACT No data
Right 1033629459 7:143142331-143142353 TTTTGTAGAGATTGGGCAGGGGG No data
1033629452_1033629459 5 Left 1033629452 7:143142303-143142325 CCTCACCTGGCTAATTTTTTTAA 0: 109
1: 1483
2: 30513
3: 85433
4: 176135
Right 1033629459 7:143142331-143142353 TTTTGTAGAGATTGGGCAGGGGG No data
1033629451_1033629459 8 Left 1033629451 7:143142300-143142322 CCACCTCACCTGGCTAATTTTTT 0: 119
1: 10443
2: 56689
3: 130269
4: 193688
Right 1033629459 7:143142331-143142353 TTTTGTAGAGATTGGGCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033629459 Original CRISPR TTTTGTAGAGATTGGGCAGG GGG Intergenic
No off target data available for this crispr