ID: 1033629463

View in Genome Browser
Species Human (GRCh38)
Location 7:143142356-143142378
Sequence CCTCACTATGTTGCCTAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033629453_1033629463 25 Left 1033629453 7:143142308-143142330 CCTGGCTAATTTTTTTAAAAACT No data
Right 1033629463 7:143142356-143142378 CCTCACTATGTTGCCTAGGGTGG No data
1033629452_1033629463 30 Left 1033629452 7:143142303-143142325 CCTCACCTGGCTAATTTTTTTAA 0: 109
1: 1483
2: 30513
3: 85433
4: 176135
Right 1033629463 7:143142356-143142378 CCTCACTATGTTGCCTAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033629463 Original CRISPR CCTCACTATGTTGCCTAGGG TGG Intergenic
No off target data available for this crispr