ID: 1033630080

View in Genome Browser
Species Human (GRCh38)
Location 7:143148958-143148980
Sequence CAGAGTGAACAGAGGGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033630080_1033630086 4 Left 1033630080 7:143148958-143148980 CCTGCACCCCTCTGTTCACTCTG No data
Right 1033630086 7:143148985-143149007 CCTGCTTCCATTCTCCCTCCTGG No data
1033630080_1033630087 5 Left 1033630080 7:143148958-143148980 CCTGCACCCCTCTGTTCACTCTG No data
Right 1033630087 7:143148986-143149008 CTGCTTCCATTCTCCCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033630080 Original CRISPR CAGAGTGAACAGAGGGGTGC AGG (reversed) Intergenic
No off target data available for this crispr