ID: 1033630086

View in Genome Browser
Species Human (GRCh38)
Location 7:143148985-143149007
Sequence CCTGCTTCCATTCTCCCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033630080_1033630086 4 Left 1033630080 7:143148958-143148980 CCTGCACCCCTCTGTTCACTCTG No data
Right 1033630086 7:143148985-143149007 CCTGCTTCCATTCTCCCTCCTGG No data
1033630081_1033630086 -2 Left 1033630081 7:143148964-143148986 CCCCTCTGTTCACTCTGTCCTCC No data
Right 1033630086 7:143148985-143149007 CCTGCTTCCATTCTCCCTCCTGG No data
1033630078_1033630086 12 Left 1033630078 7:143148950-143148972 CCTCACTCCCTGCACCCCTCTGT No data
Right 1033630086 7:143148985-143149007 CCTGCTTCCATTCTCCCTCCTGG No data
1033630083_1033630086 -4 Left 1033630083 7:143148966-143148988 CCTCTGTTCACTCTGTCCTCCTG No data
Right 1033630086 7:143148985-143149007 CCTGCTTCCATTCTCCCTCCTGG No data
1033630082_1033630086 -3 Left 1033630082 7:143148965-143148987 CCCTCTGTTCACTCTGTCCTCCT No data
Right 1033630086 7:143148985-143149007 CCTGCTTCCATTCTCCCTCCTGG No data
1033630079_1033630086 5 Left 1033630079 7:143148957-143148979 CCCTGCACCCCTCTGTTCACTCT No data
Right 1033630086 7:143148985-143149007 CCTGCTTCCATTCTCCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033630086 Original CRISPR CCTGCTTCCATTCTCCCTCC TGG Intergenic
No off target data available for this crispr