ID: 1033631900

View in Genome Browser
Species Human (GRCh38)
Location 7:143166495-143166517
Sequence CAGTGTGACCAAAGAAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033631900_1033631908 26 Left 1033631900 7:143166495-143166517 CCTTCCTTTCTTTGGTCACACTG No data
Right 1033631908 7:143166544-143166566 ATCAATGGGTTGAAAGACATGGG No data
1033631900_1033631905 11 Left 1033631900 7:143166495-143166517 CCTTCCTTTCTTTGGTCACACTG No data
Right 1033631905 7:143166529-143166551 TAGCGATTGTCTAAAATCAATGG No data
1033631900_1033631907 25 Left 1033631900 7:143166495-143166517 CCTTCCTTTCTTTGGTCACACTG No data
Right 1033631907 7:143166543-143166565 AATCAATGGGTTGAAAGACATGG No data
1033631900_1033631906 12 Left 1033631900 7:143166495-143166517 CCTTCCTTTCTTTGGTCACACTG No data
Right 1033631906 7:143166530-143166552 AGCGATTGTCTAAAATCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033631900 Original CRISPR CAGTGTGACCAAAGAAAGGA AGG (reversed) Intergenic
No off target data available for this crispr