ID: 1033631927

View in Genome Browser
Species Human (GRCh38)
Location 7:143166812-143166834
Sequence CTAAGATTTCATAGTAATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033631927_1033631931 4 Left 1033631927 7:143166812-143166834 CCACCATTACTATGAAATCTTAG No data
Right 1033631931 7:143166839-143166861 TAGTATCACTGATTTTCTGTAGG No data
1033631927_1033631932 25 Left 1033631927 7:143166812-143166834 CCACCATTACTATGAAATCTTAG No data
Right 1033631932 7:143166860-143166882 GGTGTACTGAAAATTGCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033631927 Original CRISPR CTAAGATTTCATAGTAATGG TGG (reversed) Intergenic
No off target data available for this crispr