ID: 1033631931

View in Genome Browser
Species Human (GRCh38)
Location 7:143166839-143166861
Sequence TAGTATCACTGATTTTCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033631929_1033631931 1 Left 1033631929 7:143166815-143166837 CCATTACTATGAAATCTTAGGCC No data
Right 1033631931 7:143166839-143166861 TAGTATCACTGATTTTCTGTAGG No data
1033631927_1033631931 4 Left 1033631927 7:143166812-143166834 CCACCATTACTATGAAATCTTAG No data
Right 1033631931 7:143166839-143166861 TAGTATCACTGATTTTCTGTAGG No data
1033631926_1033631931 18 Left 1033631926 7:143166798-143166820 CCTTTTTAAATATGCCACCATTA No data
Right 1033631931 7:143166839-143166861 TAGTATCACTGATTTTCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033631931 Original CRISPR TAGTATCACTGATTTTCTGT AGG Intergenic
No off target data available for this crispr