ID: 1033631932

View in Genome Browser
Species Human (GRCh38)
Location 7:143166860-143166882
Sequence GGTGTACTGAAAATTGCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033631929_1033631932 22 Left 1033631929 7:143166815-143166837 CCATTACTATGAAATCTTAGGCC No data
Right 1033631932 7:143166860-143166882 GGTGTACTGAAAATTGCAAGAGG No data
1033631930_1033631932 1 Left 1033631930 7:143166836-143166858 CCTTAGTATCACTGATTTTCTGT No data
Right 1033631932 7:143166860-143166882 GGTGTACTGAAAATTGCAAGAGG No data
1033631927_1033631932 25 Left 1033631927 7:143166812-143166834 CCACCATTACTATGAAATCTTAG No data
Right 1033631932 7:143166860-143166882 GGTGTACTGAAAATTGCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033631932 Original CRISPR GGTGTACTGAAAATTGCAAG AGG Intergenic
No off target data available for this crispr