ID: 1033632819

View in Genome Browser
Species Human (GRCh38)
Location 7:143177238-143177260
Sequence GTCTTGCTTGGTATTCAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033632819_1033632822 20 Left 1033632819 7:143177238-143177260 CCCTTCTGAATACCAAGCAAGAC No data
Right 1033632822 7:143177281-143177303 TAAAGTCCAAACTGCATTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033632819 Original CRISPR GTCTTGCTTGGTATTCAGAA GGG (reversed) Intergenic
No off target data available for this crispr