ID: 1033635016

View in Genome Browser
Species Human (GRCh38)
Location 7:143204290-143204312
Sequence CAAAGAGAAATGCCCAGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033635011_1033635016 28 Left 1033635011 7:143204239-143204261 CCCTCACTGCTGATATCAGAATT No data
Right 1033635016 7:143204290-143204312 CAAAGAGAAATGCCCAGGATGGG No data
1033635012_1033635016 27 Left 1033635012 7:143204240-143204262 CCTCACTGCTGATATCAGAATTA No data
Right 1033635016 7:143204290-143204312 CAAAGAGAAATGCCCAGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033635016 Original CRISPR CAAAGAGAAATGCCCAGGAT GGG Intergenic
No off target data available for this crispr