ID: 1033636548

View in Genome Browser
Species Human (GRCh38)
Location 7:143217507-143217529
Sequence ACTTGGGGCAACAGGAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033636548_1033636557 9 Left 1033636548 7:143217507-143217529 CCACTTTTCCTGTTGCCCCAAGT No data
Right 1033636557 7:143217539-143217561 GCTCATACTAAAAACCATAAGGG No data
1033636548_1033636559 25 Left 1033636548 7:143217507-143217529 CCACTTTTCCTGTTGCCCCAAGT No data
Right 1033636559 7:143217555-143217577 ATAAGGGTAAGTCCCCCCAAAGG No data
1033636548_1033636556 8 Left 1033636548 7:143217507-143217529 CCACTTTTCCTGTTGCCCCAAGT No data
Right 1033636556 7:143217538-143217560 AGCTCATACTAAAAACCATAAGG No data
1033636548_1033636560 26 Left 1033636548 7:143217507-143217529 CCACTTTTCCTGTTGCCCCAAGT No data
Right 1033636560 7:143217556-143217578 TAAGGGTAAGTCCCCCCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033636548 Original CRISPR ACTTGGGGCAACAGGAAAAG TGG (reversed) Intergenic
No off target data available for this crispr