ID: 1033641743

View in Genome Browser
Species Human (GRCh38)
Location 7:143268361-143268383
Sequence CCTCAGTGGGAGGCTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179594
Summary {0: 1, 1: 7, 2: 148, 3: 6165, 4: 173273}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033641735_1033641743 20 Left 1033641735 7:143268318-143268340 CCGTCTCTACTAAAAATATAAAA 0: 8307
1: 209456
2: 146501
3: 70665
4: 55610
Right 1033641743 7:143268361-143268383 CCTCAGTGGGAGGCTGAGGCAGG 0: 1
1: 7
2: 148
3: 6165
4: 173273
1033641733_1033641743 22 Left 1033641733 7:143268316-143268338 CCCCGTCTCTACTAAAAATATAA 0: 3689
1: 111934
2: 231588
3: 161087
4: 96730
Right 1033641743 7:143268361-143268383 CCTCAGTGGGAGGCTGAGGCAGG 0: 1
1: 7
2: 148
3: 6165
4: 173273
1033641734_1033641743 21 Left 1033641734 7:143268317-143268339 CCCGTCTCTACTAAAAATATAAA 0: 6802
1: 180538
2: 221127
3: 132961
4: 86030
Right 1033641743 7:143268361-143268383 CCTCAGTGGGAGGCTGAGGCAGG 0: 1
1: 7
2: 148
3: 6165
4: 173273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033641743 Original CRISPR CCTCAGTGGGAGGCTGAGGC AGG Intronic
Too many off-targets to display for this crispr