ID: 1033643815

View in Genome Browser
Species Human (GRCh38)
Location 7:143286245-143286267
Sequence CTACAGGGAGAGAGGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2713
Summary {0: 1, 1: 1, 2: 24, 3: 237, 4: 2450}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033643815_1033643823 14 Left 1033643815 7:143286245-143286267 CCATCCTCCCTCTCTCCCTGTAG 0: 1
1: 1
2: 24
3: 237
4: 2450
Right 1033643823 7:143286282-143286304 AGTCTCTGGTTTCCTGTCATTGG 0: 1
1: 0
2: 2
3: 20
4: 215
1033643815_1033643825 24 Left 1033643815 7:143286245-143286267 CCATCCTCCCTCTCTCCCTGTAG 0: 1
1: 1
2: 24
3: 237
4: 2450
Right 1033643825 7:143286292-143286314 TTCCTGTCATTGGCATCAGCGGG 0: 1
1: 0
2: 1
3: 17
4: 196
1033643815_1033643822 0 Left 1033643815 7:143286245-143286267 CCATCCTCCCTCTCTCCCTGTAG 0: 1
1: 1
2: 24
3: 237
4: 2450
Right 1033643822 7:143286268-143286290 TCTCTGAGGCAGAGAGTCTCTGG 0: 1
1: 1
2: 2
3: 29
4: 288
1033643815_1033643824 23 Left 1033643815 7:143286245-143286267 CCATCCTCCCTCTCTCCCTGTAG 0: 1
1: 1
2: 24
3: 237
4: 2450
Right 1033643824 7:143286291-143286313 TTTCCTGTCATTGGCATCAGCGG 0: 1
1: 0
2: 1
3: 12
4: 190
1033643815_1033643828 30 Left 1033643815 7:143286245-143286267 CCATCCTCCCTCTCTCCCTGTAG 0: 1
1: 1
2: 24
3: 237
4: 2450
Right 1033643828 7:143286298-143286320 TCATTGGCATCAGCGGGAGGAGG 0: 1
1: 0
2: 0
3: 7
4: 120
1033643815_1033643827 27 Left 1033643815 7:143286245-143286267 CCATCCTCCCTCTCTCCCTGTAG 0: 1
1: 1
2: 24
3: 237
4: 2450
Right 1033643827 7:143286295-143286317 CTGTCATTGGCATCAGCGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033643815 Original CRISPR CTACAGGGAGAGAGGGAGGA TGG (reversed) Intronic
Too many off-targets to display for this crispr