ID: 1033647597

View in Genome Browser
Species Human (GRCh38)
Location 7:143317215-143317237
Sequence GAATTTGTCTAGAGGGCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033647592_1033647597 9 Left 1033647592 7:143317183-143317205 CCTCCAAAGAATGCAGAGAATAA 0: 1
1: 0
2: 2
3: 39
4: 375
Right 1033647597 7:143317215-143317237 GAATTTGTCTAGAGGGCAGTTGG No data
1033647593_1033647597 6 Left 1033647593 7:143317186-143317208 CCAAAGAATGCAGAGAATAACAG 0: 1
1: 0
2: 0
3: 22
4: 372
Right 1033647597 7:143317215-143317237 GAATTTGTCTAGAGGGCAGTTGG No data
1033647590_1033647597 15 Left 1033647590 7:143317177-143317199 CCTCTCCCTCCAAAGAATGCAGA 0: 1
1: 0
2: 2
3: 23
4: 390
Right 1033647597 7:143317215-143317237 GAATTTGTCTAGAGGGCAGTTGG No data
1033647591_1033647597 10 Left 1033647591 7:143317182-143317204 CCCTCCAAAGAATGCAGAGAATA 0: 1
1: 0
2: 1
3: 23
4: 314
Right 1033647597 7:143317215-143317237 GAATTTGTCTAGAGGGCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033647597 Original CRISPR GAATTTGTCTAGAGGGCAGT TGG Intronic
No off target data available for this crispr