ID: 1033651353

View in Genome Browser
Species Human (GRCh38)
Location 7:143346194-143346216
Sequence GAGCCCAATGGGCCTCTGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 153}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033651344_1033651353 6 Left 1033651344 7:143346165-143346187 CCTCTACTACTGCCCCTCTGTCC 0: 1
1: 0
2: 0
3: 22
4: 302
Right 1033651353 7:143346194-143346216 GAGCCCAATGGGCCTCTGCCTGG 0: 1
1: 0
2: 1
3: 17
4: 153
1033651341_1033651353 11 Left 1033651341 7:143346160-143346182 CCACCCCTCTACTACTGCCCCTC 0: 1
1: 0
2: 4
3: 44
4: 505
Right 1033651353 7:143346194-143346216 GAGCCCAATGGGCCTCTGCCTGG 0: 1
1: 0
2: 1
3: 17
4: 153
1033651339_1033651353 21 Left 1033651339 7:143346150-143346172 CCCTTGCTCTCCACCCCTCTACT 0: 1
1: 0
2: 2
3: 76
4: 797
Right 1033651353 7:143346194-143346216 GAGCCCAATGGGCCTCTGCCTGG 0: 1
1: 0
2: 1
3: 17
4: 153
1033651342_1033651353 8 Left 1033651342 7:143346163-143346185 CCCCTCTACTACTGCCCCTCTGT 0: 1
1: 1
2: 2
3: 22
4: 226
Right 1033651353 7:143346194-143346216 GAGCCCAATGGGCCTCTGCCTGG 0: 1
1: 0
2: 1
3: 17
4: 153
1033651345_1033651353 -6 Left 1033651345 7:143346177-143346199 CCCCTCTGTCCCCAGAAGAGCCC 0: 1
1: 0
2: 4
3: 40
4: 367
Right 1033651353 7:143346194-143346216 GAGCCCAATGGGCCTCTGCCTGG 0: 1
1: 0
2: 1
3: 17
4: 153
1033651347_1033651353 -8 Left 1033651347 7:143346179-143346201 CCTCTGTCCCCAGAAGAGCCCAA 0: 1
1: 0
2: 2
3: 31
4: 363
Right 1033651353 7:143346194-143346216 GAGCCCAATGGGCCTCTGCCTGG 0: 1
1: 0
2: 1
3: 17
4: 153
1033651338_1033651353 25 Left 1033651338 7:143346146-143346168 CCTTCCCTTGCTCTCCACCCCTC 0: 1
1: 2
2: 30
3: 325
4: 2922
Right 1033651353 7:143346194-143346216 GAGCCCAATGGGCCTCTGCCTGG 0: 1
1: 0
2: 1
3: 17
4: 153
1033651340_1033651353 20 Left 1033651340 7:143346151-143346173 CCTTGCTCTCCACCCCTCTACTA 0: 1
1: 0
2: 4
3: 30
4: 360
Right 1033651353 7:143346194-143346216 GAGCCCAATGGGCCTCTGCCTGG 0: 1
1: 0
2: 1
3: 17
4: 153
1033651343_1033651353 7 Left 1033651343 7:143346164-143346186 CCCTCTACTACTGCCCCTCTGTC 0: 1
1: 0
2: 2
3: 14
4: 264
Right 1033651353 7:143346194-143346216 GAGCCCAATGGGCCTCTGCCTGG 0: 1
1: 0
2: 1
3: 17
4: 153
1033651337_1033651353 28 Left 1033651337 7:143346143-143346165 CCTCCTTCCCTTGCTCTCCACCC 0: 1
1: 0
2: 11
3: 174
4: 1531
Right 1033651353 7:143346194-143346216 GAGCCCAATGGGCCTCTGCCTGG 0: 1
1: 0
2: 1
3: 17
4: 153
1033651346_1033651353 -7 Left 1033651346 7:143346178-143346200 CCCTCTGTCCCCAGAAGAGCCCA 0: 2
1: 0
2: 1
3: 39
4: 322
Right 1033651353 7:143346194-143346216 GAGCCCAATGGGCCTCTGCCTGG 0: 1
1: 0
2: 1
3: 17
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033651353 Original CRISPR GAGCCCAATGGGCCTCTGCC TGG Exonic
900142448 1:1144401-1144423 GAGGCCACTGGGCCTCTGCCGGG - Intergenic
900289434 1:1917669-1917691 AGGCCCAAGGGGCCTCTTCCAGG + Exonic
900481806 1:2902983-2903005 GAGCCCCATTGGCCCCTCCCTGG + Intergenic
900592195 1:3465110-3465132 GAGCCCCATGGGCCTGGGCCTGG - Intronic
903776408 1:25796917-25796939 AAGCCAAATGGCCCTCTTCCTGG + Intergenic
904813497 1:33179375-33179397 GAGGCCCATGGGCATCTGCTGGG + Intronic
907616736 1:55933962-55933984 GTCCCTAATGGGCCACTGCCTGG - Intergenic
908615539 1:65917546-65917568 GGCCCAAATGAGCCTCTGCCTGG - Intronic
912454539 1:109788835-109788857 GACCCCAGTGGTCCTCTGCAGGG + Intergenic
912566966 1:110594556-110594578 CAGCCAAATTGGCCTCTTCCTGG - Intronic
912975537 1:114326678-114326700 GTGCCCATTGCCCCTCTGCCTGG - Intergenic
917669062 1:177255752-177255774 GAGGCCAAGGGGCCTCTTCCAGG + Intronic
923614465 1:235525393-235525415 GAGCCCAAAGAGGCTCTGCAAGG - Intergenic
1063613125 10:7580024-7580046 GAGCCTGATGGCCCTCTGCAGGG + Exonic
1065685533 10:28280833-28280855 GAGACAAATGGGCATGTGCCTGG + Intronic
1069606230 10:69740408-69740430 GAGAGCAAAGGGCCTCTGCCGGG + Intergenic
1069942679 10:71965757-71965779 AAGGCCAGTGGGCCTCTGCTGGG + Intronic
1070589133 10:77789175-77789197 CAGCCAAATGGGCCTCCTCCTGG - Intergenic
1070647560 10:78212327-78212349 GAGCCTACTGGGCCCATGCCAGG - Intergenic
1070754672 10:78984627-78984649 TAGCATTATGGGCCTCTGCCTGG - Intergenic
1074359950 10:112817674-112817696 GAGAGCAATTGGCCTCTGCTGGG - Exonic
1074761422 10:116669950-116669972 GTGCCCACTTGGCCTCTGCCCGG + Exonic
1076546450 10:131248804-131248826 GAGCAGAAGGAGCCTCTGCCGGG - Intronic
1076638869 10:131900876-131900898 GCGCCCAATGCGCCTGCGCCCGG - Exonic
1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG + Intergenic
1078564646 11:12404065-12404087 GAGCCAACTGGGCAGCTGCCTGG - Intronic
1079093374 11:17495726-17495748 AAGCCCCATGGAGCTCTGCCTGG - Intronic
1083153910 11:60810894-60810916 GAGCCCAAGGGGGCTGTGCGAGG + Intergenic
1083304602 11:61755884-61755906 GAGTTTAGTGGGCCTCTGCCCGG + Intronic
1089670655 11:120054746-120054768 TACCCCAAGGGGCCTCTCCCAGG + Intergenic
1091384632 12:85279-85301 AAAGCCATTGGGCCTCTGCCAGG - Intronic
1091787494 12:3251929-3251951 AAGCCCAGTGGCCCCCTGCCAGG - Intronic
1092844119 12:12568299-12568321 TAGGCCAGTGGGCCTCAGCCTGG + Intergenic
1097536021 12:60872231-60872253 GTGGCCAGTGGGCCTTTGCCTGG + Intergenic
1102526370 12:113515150-113515172 GAGGCCAAGGGGCCGCCGCCCGG + Intergenic
1102682187 12:114698373-114698395 GCGCCCCAAGAGCCTCTGCCAGG - Intergenic
1103903694 12:124316491-124316513 GAGCCCCATGGGCCTCTCCAAGG - Intergenic
1106383700 13:29264439-29264461 GTCCCCAATGGGGCACTGCCTGG - Intronic
1109188690 13:59300066-59300088 GAGCCACAAGGGCATCTGCCAGG - Intergenic
1110166577 13:72449709-72449731 GAGCCTAAGGGGCCTCTAACGGG + Intergenic
1115513225 14:34158870-34158892 GAGTGCAATGAGACTCTGCCAGG + Intronic
1119078495 14:71668836-71668858 GATTCCAAAGGGCCTCTGCTTGG - Intronic
1121463567 14:94100286-94100308 GAGACCAAGGCGCCTCTTCCTGG + Intronic
1122530939 14:102426494-102426516 GAGCTCAGCGGGCCTCTGACAGG + Intronic
1122921090 14:104880452-104880474 GAGCACACAGGGCCACTGCCAGG + Intronic
1123488328 15:20760564-20760586 GAGGGCAATGGGCCTTTGACAGG + Intergenic
1123544826 15:21329637-21329659 GAGGGCAATGGGCCTTTGACAGG + Intergenic
1130756271 15:86767303-86767325 GAGACGAATGGGCCTTTGTCTGG + Intronic
1202953171 15_KI270727v1_random:56908-56930 GAGGGCAATGGGCCTTTGACAGG + Intergenic
1132804653 16:1769857-1769879 CAGCCCCACGGGCCTCTGCTTGG - Exonic
1134207569 16:12250389-12250411 AGGCCGAATGGCCCTCTGCCCGG - Intronic
1136624217 16:31451929-31451951 GAGCCAAAGAGGCCTCTGCCGGG - Intergenic
1137785846 16:51137200-51137222 GAGCCCAATGCTCCCCTGGCCGG - Exonic
1138247271 16:55477360-55477382 GAGCCCAGTGGGGCTGGGCCAGG + Intronic
1139354976 16:66362140-66362162 GAGCCCAGTGTGGCACTGCCCGG - Intergenic
1142139299 16:88465618-88465640 CTGGCCAATGGGACTCTGCCTGG - Intronic
1142186129 16:88695526-88695548 GAGCCACGTGGGCCTCTGACTGG - Intergenic
1144493265 17:15732202-15732224 CATCACAATGGGCCCCTGCCTGG - Intergenic
1144624257 17:16836753-16836775 AAGCCCAATGGGCATCCTCCAGG + Intergenic
1144906996 17:18644450-18644472 CATCACAATGGGCCCCTGCCTGG + Intronic
1147215794 17:38898351-38898373 GAGCCGAAAGGGCCTCGGCTTGG - Intronic
1148731313 17:49838481-49838503 GAACCCACTGGGCTTCTTCCTGG - Exonic
1150267582 17:63841345-63841367 GATCCCTAAGGACCTCTGCCTGG + Intronic
1150283951 17:63945165-63945187 TAGCCCAGTGGGGCTCTGGCAGG - Intronic
1150488350 17:65559348-65559370 GAGCCCAATCCGCCTATGCTGGG - Intronic
1151127417 17:71859889-71859911 GTGCTCAATGGGCCTGGGCCTGG - Intergenic
1151541477 17:74767135-74767157 GAACCCTCTTGGCCTCTGCCTGG + Intronic
1152230073 17:79109951-79109973 GAACCCACTTAGCCTCTGCCCGG - Intronic
1152545188 17:80996931-80996953 GAGCCCAGGAGGCCTCTGTCGGG + Intronic
1155815191 18:30298532-30298554 GAACCAAATGTGTCTCTGCCAGG - Intergenic
1158743319 18:60168158-60168180 GTGCCCAATGGGCCTCTTCAAGG - Intergenic
1159563796 18:70024974-70024996 GAGCCCAATGGGGCTGGGGCAGG - Intronic
1161034987 19:2079574-2079596 GAGGCCGAGGGGCATCTGCCAGG - Intronic
1162141541 19:8588422-8588444 AACCCCAATGGGACTCTACCTGG + Intronic
1163272275 19:16261540-16261562 CAGCCACACGGGCCTCTGCCAGG - Intergenic
1165273624 19:34731264-34731286 GAGCCCTGTGGTTCTCTGCCAGG - Intergenic
1166381435 19:42357236-42357258 GGGCCCACTGTGCCTCTGCCAGG + Intronic
1167285559 19:48596941-48596963 GAGCCCACTAGGCCACTGCCCGG + Intronic
1168330327 19:55564270-55564292 GAGCCCAAAGAGCCGATGCCTGG + Intergenic
925180324 2:1813321-1813343 GAGGCCCCTGGGCCTCAGCCTGG + Intronic
927876538 2:26659039-26659061 GAGCCCGACGGGGCTCTGCTCGG - Intergenic
931997829 2:67856124-67856146 GAGGCTAGAGGGCCTCTGCCTGG - Intergenic
932815246 2:74856027-74856049 GAACCCAAGGGGCAGCTGCCAGG + Intronic
937469571 2:122163695-122163717 CAGCCCCATGGGCCACTGTCAGG + Intergenic
940882740 2:158962717-158962739 GAGCTCACTGAGCCTCAGCCTGG + Intergenic
943099416 2:183470755-183470777 GAAAACAATGGGTCTCTGCCTGG - Intergenic
948858303 2:240740846-240740868 GAGGCCAGTGGGGGTCTGCCTGG - Intronic
949014385 2:241701548-241701570 GAGCCCCCGGGGCCTCAGCCCGG - Intergenic
1172135121 20:32681500-32681522 GAGCCCAATGCTAATCTGCCTGG - Intergenic
1172280150 20:33702184-33702206 GAGCCGCAGGGTCCTCTGCCTGG + Intergenic
1172914929 20:38436328-38436350 GAATCCCATGGGCCTCTCCCAGG - Intergenic
1173838391 20:46140282-46140304 GAGCCCCATGGGGCTCTGCAGGG + Intergenic
1175733721 20:61371306-61371328 GAGCCCGAAGGGGGTCTGCCTGG - Intronic
1176169595 20:63690871-63690893 CAGCCCCCTGGGCCTCTGCCGGG - Exonic
1177890222 21:26795770-26795792 CACCACAATGGGCCTCTGTCGGG + Intergenic
1181036145 22:20170581-20170603 CTGCCCAATGGGCCTCGGGCTGG - Intergenic
1182558313 22:31140833-31140855 GGGGGCCATGGGCCTCTGCCAGG + Intergenic
1183362006 22:37387687-37387709 GAGCCCGAGGGGCCGCGGCCTGG - Intronic
1183716632 22:39537010-39537032 GAAGCCACTTGGCCTCTGCCTGG - Intergenic
1184261649 22:43320876-43320898 GAGCCCAAGGGGCCTAACCCCGG + Intronic
1184789599 22:46691676-46691698 GAGCCCCAGGGGCCTCTCCCCGG - Exonic
950692055 3:14666897-14666919 GGGCCCCATGGGCCTCTTCAGGG - Exonic
951625950 3:24663252-24663274 GAGCCCCATGGGCCTCCCCCAGG - Intergenic
952920814 3:38282656-38282678 CATCCCAAAGGTCCTCTGCCAGG - Intronic
953101784 3:39836900-39836922 GAGCCAGATGGCCCTCTGGCGGG - Intronic
955208812 3:56921668-56921690 GAGTCCAATAGGCCTTGGCCTGG - Intronic
956892251 3:73624396-73624418 GCGGCCAGTGGGCCGCTGCCAGG - Exonic
959809033 3:110593867-110593889 GTACCCAATGGGGCACTGCCTGG + Intergenic
961795796 3:129408026-129408048 GAGCCCACTGTGTCTCTGCGGGG - Intronic
967136568 3:186517384-186517406 CAGCCCAGTGAGTCTCTGCCAGG - Intergenic
967820027 3:193831741-193831763 GAGGGCAGTGAGCCTCTGCCAGG + Intergenic
969488447 4:7485466-7485488 GAGCCCCAGGGCCCCCTGCCGGG + Intronic
969517323 4:7654847-7654869 GCCCCCAGTGGCCCTCTGCCTGG - Intronic
969574372 4:8028056-8028078 CAGCACCCTGGGCCTCTGCCTGG - Intronic
972221372 4:36959534-36959556 GAGCTCTTTGGGGCTCTGCCAGG - Intergenic
978761397 4:112358569-112358591 CAGCCCCCAGGGCCTCTGCCAGG - Intronic
983888374 4:173005944-173005966 GAGCTCAAAAGGCCTCTGGCAGG - Intronic
985621203 5:957106-957128 GCCCCCACTGGGCCTCTGCTTGG - Intergenic
986064009 5:4218257-4218279 AAGCCCAGAGGGCCTCTTCCAGG + Intergenic
986692665 5:10326563-10326585 GGGCTCAATGTGCCTGTGCCGGG + Intergenic
988657405 5:33227331-33227353 GAGCCCAACTGGCCTCTGAAGGG - Intergenic
992948291 5:81831267-81831289 AAGCCCAAAGTGCTTCTGCCAGG - Intergenic
995954901 5:117766035-117766057 GAGCCCACTGCGCTTCAGCCTGG - Intergenic
999134624 5:149310246-149310268 GAGCCCAAGTGCCCTCTGCGTGG + Intronic
1001124596 5:169008028-169008050 CAGAACAATGGCCCTCTGCCTGG - Intronic
1002100315 5:176854475-176854497 GAGCCCAGTGTGGCTCAGCCGGG - Intronic
1002961063 6:1915277-1915299 CAGCCCTGTGAGCCTCTGCCAGG - Intronic
1003313709 6:4992001-4992023 AAGCACAGTGGGCATCTGCCTGG - Intergenic
1003502592 6:6714691-6714713 GAGCACACTGGGCAGCTGCCTGG + Intergenic
1003565173 6:7216454-7216476 GAGCCCAAGGGGGCTCTGACAGG + Intronic
1004521567 6:16365731-16365753 GAGGACAATGGGAATCTGCCTGG + Intronic
1009602977 6:65826887-65826909 GAGCCACAGGGGCATCTGCCAGG + Intergenic
1019522271 7:1466330-1466352 GACCCCAGTAGGCCTCCGCCAGG - Intergenic
1020762947 7:12290313-12290335 GAGCCCAGTGGGCCTCAGTGAGG + Intergenic
1022560624 7:31345606-31345628 GAAACCTCTGGGCCTCTGCCAGG - Intergenic
1023264908 7:38394246-38394268 CATCTCCATGGGCCTCTGCCAGG + Intronic
1024164075 7:46712746-46712768 GAGCACATTGTGCCTCAGCCAGG + Intronic
1027551589 7:79604186-79604208 GAGCCCTGTTGGCCTCTGCCTGG + Intergenic
1029733332 7:102451862-102451884 GAGCGCAGGGTGCCTCTGCCTGG + Exonic
1032075904 7:128836084-128836106 GAGGCCAGTGGGGCACTGCCTGG + Intronic
1033651353 7:143346194-143346216 GAGCCCAATGGGCCTCTGCCTGG + Exonic
1034412926 7:150950604-150950626 GAGCCCAAGGGTGCTCGGCCAGG - Intronic
1035167852 7:157002414-157002436 GAGCCCCCTGGGCCTCCGTCTGG + Intronic
1035568554 8:658106-658128 GTGCCCAAGTGGCCTCTGGCTGG + Intronic
1036170070 8:6475378-6475400 GAGCCACAAGGGCGTCTGCCAGG - Intronic
1037594905 8:20346882-20346904 GAGCCCCAAGGGCCGCTCCCTGG + Intergenic
1037716960 8:21408826-21408848 GAGCCCAGAGGGGCTCTGCCTGG - Intergenic
1040091251 8:43401060-43401082 GTGCCCACTGGGGCACTGCCTGG - Intergenic
1043401523 8:79889998-79890020 GAGCCACATAGGCCTCTGCAGGG + Intergenic
1046097206 8:109575919-109575941 GTGCCAACTGGGCCTCTACCCGG + Exonic
1047420782 8:124706624-124706646 GCTGCCAAAGGGCCTCTGCCAGG - Intronic
1048857970 8:138700066-138700088 GTGCCCAGTGTGCCTCGGCCTGG - Intronic
1049225140 8:141446979-141447001 GAGCCCAGTTCGCCTCTGCATGG + Intergenic
1049537260 8:143188168-143188190 GGGCCCACTGGGCTTCTGCTGGG + Intergenic
1049739600 8:144231385-144231407 GAGGCCAGAGTGCCTCTGCCCGG - Intronic
1051232620 9:14968127-14968149 GAGCCAGATGGCCCTCTGGCGGG + Intergenic
1053485981 9:38456601-38456623 GAGCCCCAAAGGGCTCTGCCTGG - Intergenic
1056601826 9:88052810-88052832 GTGGCCAGTGAGCCTCTGCCTGG - Intergenic
1056897607 9:90565530-90565552 GAGCCACATGGGCCTCTCCCAGG + Intergenic
1060411138 9:123401077-123401099 GATCCTAATGGGCCTTTGTCAGG - Intronic
1060771988 9:126338396-126338418 GATGACAATGGCCCTCTGCCTGG - Intronic
1061419713 9:130466621-130466643 GACCCCCATGGGCCCCTCCCAGG + Intronic
1061961217 9:133990296-133990318 GGGCTCAAGGGGCCTCTGTCAGG + Intronic
1062212989 9:135374503-135374525 GGGGCCAATGGGTTTCTGCCAGG + Intergenic
1062482096 9:136757240-136757262 GAGCCCAGCAGGCCCCTGCCCGG - Intronic
1062690265 9:137837915-137837937 GAGCCCAGGGGGCCCCAGCCGGG + Intronic
1187171302 X:16854760-16854782 GAGGCCATGGGGCCTCTGCTTGG + Intronic
1189301271 X:39954271-39954293 GACCCCAATGGGCCCTTTCCTGG - Intergenic
1199673265 X:150164049-150164071 GGGCTCAGTGGGCCTCTACCAGG - Intergenic
1200137958 X:153884001-153884023 GCCCCCAATCGGCCTCTCCCAGG - Intronic
1201858150 Y:18568004-18568026 GAGGCCAGTGGGCACCTGCCAGG + Intronic
1201875171 Y:18752377-18752399 GAGGCCAGTGGGCACCTGCCAGG - Intronic