ID: 1033652393

View in Genome Browser
Species Human (GRCh38)
Location 7:143352875-143352897
Sequence GGGAGTAACCTGGACACTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033652393_1033652402 23 Left 1033652393 7:143352875-143352897 CCTCCAGTGTCCAGGTTACTCCC No data
Right 1033652402 7:143352921-143352943 TTATTGACTTGTCCTGCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033652393 Original CRISPR GGGAGTAACCTGGACACTGG AGG (reversed) Intergenic
No off target data available for this crispr