ID: 1033653063

View in Genome Browser
Species Human (GRCh38)
Location 7:143356456-143356478
Sequence CCAGCAGTACAGCTGAAACT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 178}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033653063_1033653078 18 Left 1033653063 7:143356456-143356478 CCCAGTTTCAGCTGTACTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 178
Right 1033653078 7:143356497-143356519 TCACAGCCATGGCCCTCAGGTGG 0: 1
1: 0
2: 1
3: 20
4: 212
1033653063_1033653082 28 Left 1033653063 7:143356456-143356478 CCCAGTTTCAGCTGTACTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 178
Right 1033653082 7:143356507-143356529 GGCCCTCAGGTGGGAGTGGAAGG 0: 1
1: 0
2: 1
3: 38
4: 402
1033653063_1033653074 -6 Left 1033653063 7:143356456-143356478 CCCAGTTTCAGCTGTACTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 178
Right 1033653074 7:143356473-143356495 TGCTGGGGGGAGGGAGGGTATGG 0: 1
1: 0
2: 11
3: 148
4: 1507
1033653063_1033653081 24 Left 1033653063 7:143356456-143356478 CCCAGTTTCAGCTGTACTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 178
Right 1033653081 7:143356503-143356525 CCATGGCCCTCAGGTGGGAGTGG 0: 1
1: 0
2: 1
3: 39
4: 372
1033653063_1033653076 7 Left 1033653063 7:143356456-143356478 CCCAGTTTCAGCTGTACTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 178
Right 1033653076 7:143356486-143356508 GAGGGTATGGGTCACAGCCATGG 0: 1
1: 0
2: 0
3: 20
4: 244
1033653063_1033653077 15 Left 1033653063 7:143356456-143356478 CCCAGTTTCAGCTGTACTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 178
Right 1033653077 7:143356494-143356516 GGGTCACAGCCATGGCCCTCAGG 0: 1
1: 0
2: 0
3: 32
4: 244
1033653063_1033653075 -5 Left 1033653063 7:143356456-143356478 CCCAGTTTCAGCTGTACTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 178
Right 1033653075 7:143356474-143356496 GCTGGGGGGAGGGAGGGTATGGG 0: 1
1: 0
2: 12
3: 138
4: 1298
1033653063_1033653079 19 Left 1033653063 7:143356456-143356478 CCCAGTTTCAGCTGTACTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 178
Right 1033653079 7:143356498-143356520 CACAGCCATGGCCCTCAGGTGGG 0: 1
1: 0
2: 0
3: 21
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033653063 Original CRISPR CCAGCAGTACAGCTGAAACT GGG (reversed) Exonic
900709783 1:4106484-4106506 CCAGCATTACAGCTGAAAGAGGG + Intergenic
901833235 1:11906855-11906877 CCAGCAGTTCAGCTGCTACAGGG + Intergenic
902444704 1:16455091-16455113 CCAGGAGAACAGATAAAACTAGG - Intronic
902705566 1:18201781-18201803 CTATCAGTACAGCTCAGACTTGG - Intronic
903155306 1:21438849-21438871 CCAGGAGAACAGATAAAACTAGG - Intergenic
904028718 1:27520835-27520857 CCAGCATTCCAGCTGCCACTGGG - Intergenic
904279740 1:29410491-29410513 CAAGAAGTGCAACTGAAACTAGG + Intergenic
906541036 1:46586206-46586228 CCCGCAGTAAAGCTGCACCTTGG + Intronic
907146877 1:52242691-52242713 CCATCAGTACATAAGAAACTAGG - Intronic
908118472 1:60963886-60963908 CCATCACTACAGCTGAAATATGG + Intronic
912779149 1:112527679-112527701 CCAGGAGTAGACCTGAAAATGGG - Intronic
913362549 1:117998459-117998481 CCTGTAGTACAGCTGAAGTTGGG + Intronic
915433565 1:155886002-155886024 ACAGAAGTACAGCTAAAACAGGG + Intergenic
919701026 1:200631124-200631146 CCAGCACTAAAGCTAAAAGTGGG + Intronic
920502833 1:206496317-206496339 GAAGCAGCACAGCTGAGACTGGG + Exonic
1064367141 10:14718231-14718253 GCAGCAGAATAGCTGAAACCTGG + Intronic
1065053053 10:21815514-21815536 CCAGCAGTATCTATGAAACTAGG + Intronic
1065574665 10:27105307-27105329 CCAGCAGCACAGCAGAACCTGGG + Intergenic
1065599034 10:27349894-27349916 TCTGCAGTCCTGCTGAAACTCGG - Intergenic
1067288752 10:44926570-44926592 CCAGCAGGGCAGCTGGAACCTGG + Intronic
1068569692 10:58615782-58615804 TAAGCAGTACAGCTGCCACTGGG - Intronic
1069595258 10:69666066-69666088 CCAGGAGTGCAGCTGAGGCTGGG + Intergenic
1072407714 10:95170294-95170316 CAAGCAAGACAACTGAAACTGGG - Intergenic
1074016002 10:109534577-109534599 CGAGCAGAACAGCTGAGATTAGG - Intergenic
1074141895 10:110680491-110680513 CCAGGAGAACAGATGAGACTTGG - Intronic
1074773260 10:116747081-116747103 CCAGCCTTACAGCTGAATCATGG + Intergenic
1075979187 10:126722429-126722451 CCTGCAGGACAGCTGAATGTTGG - Intergenic
1077407754 11:2390275-2390297 CCAGCAGCAGAGCTGACACCTGG + Intronic
1079477986 11:20851330-20851352 CCAGCTAAACAGCTGAAACAAGG - Intronic
1080247512 11:30196299-30196321 CTATTAGTACAGCTAAAACTGGG - Intergenic
1081258479 11:40927842-40927864 CCAGTAATTCAGCAGAAACTAGG - Intronic
1082709781 11:56540653-56540675 ACAAGAGTACAGCTGAATCTCGG - Intergenic
1084311713 11:68320553-68320575 CCAGGAGAACAGCTGGAACCCGG - Intronic
1084359691 11:68661386-68661408 CCAGCTGTATTGCTGAGACTGGG + Intergenic
1084395431 11:68906217-68906239 CCAGAAGTAAAGCTGTTACTGGG - Exonic
1085925090 11:81008863-81008885 AAAGCAATACAGCAGAAACTAGG + Intergenic
1085968068 11:81553230-81553252 GCAGCAGTACTCCTAAAACTAGG + Intergenic
1087153089 11:94876331-94876353 GCAGCAGGACAGCTGAAATCGGG - Exonic
1089758584 11:120706322-120706344 CCAGGAGTCCAGAAGAAACTGGG - Intronic
1090436385 11:126690114-126690136 GAAGTAGTGCAGCTGAAACTGGG - Intronic
1092065027 12:5582909-5582931 CCAGCACTGCAGGTGGAACTCGG + Intronic
1097007277 12:55928299-55928321 CCAGCAGTACCCCTGGAACCAGG + Intronic
1099848673 12:88062705-88062727 GCAGAAGTTCAGCGGAAACTTGG - Exonic
1100592692 12:96044227-96044249 CCAGAAGAAAAGCTGGAACTGGG + Intergenic
1102187888 12:110964048-110964070 AAAGTAGTACAGATGAAACTTGG - Intergenic
1105007998 12:132734976-132734998 CCAGTTGTACACCTGACACTGGG + Intronic
1107774196 13:43821315-43821337 GCAGGAGAACAGCTTAAACTTGG - Intergenic
1108493438 13:51002761-51002783 GCAGCATTTCAGCTGAGACTTGG - Intergenic
1109323692 13:60840832-60840854 CCAGCAATACATCTGAAAAGAGG - Intergenic
1110241000 13:73266663-73266685 CCTTCAGCACAGCTGAAATTGGG + Intergenic
1111170494 13:84520804-84520826 CCAGCAGTACTCCTAAAATTAGG + Intergenic
1112839714 13:103561345-103561367 CTATCAGTACATCTGCAACTGGG - Intergenic
1113823140 13:113229826-113229848 CCAGCGCTGCAGTTGAAACTCGG + Intronic
1114057222 14:18981979-18982001 CCAACAGCACAGCTGAAAGAGGG - Intronic
1114105324 14:19419767-19419789 CCAACAGCACAGCTGAAAGAGGG + Intronic
1116378711 14:44236658-44236680 CCAGGAGTTCATCTGAGACTTGG + Intergenic
1117570994 14:57049259-57049281 CCAGCGGTAAAGCTGAATATTGG - Intergenic
1122330281 14:100907354-100907376 CCAGCACCACAGCTGGGACTTGG - Intergenic
1122715317 14:103693446-103693468 CCAGCTGCACAGCTAAATCTAGG - Intergenic
1123498220 15:20852201-20852223 CCAACAGCACAGCTGAAAGAGGG + Intronic
1123555451 15:21425829-21425851 CCAACAGCACAGCTGAAAGAGGG + Intronic
1123591694 15:21863160-21863182 CCAACAGCACAGCTGAAAGAGGG + Intergenic
1125843016 15:42823230-42823252 CCAGCTGAAGGGCTGAAACTGGG + Intronic
1126082159 15:44974210-44974232 CCAGAACAACAGCTTAAACTGGG - Intronic
1126872815 15:53008111-53008133 CCAGGAGCCCAGCTAAAACTGGG + Intergenic
1129258206 15:74346438-74346460 ACAGCAATACAGATGATACTTGG - Intronic
1131086497 15:89579911-89579933 ACAACAGAATAGCTGAAACTGGG - Intronic
1202963795 15_KI270727v1_random:153039-153061 CCAACAGCACAGCTGAAAGAGGG + Intergenic
1133177457 16:4025950-4025972 CCAGCTGGACAGCTGACAGTGGG + Intronic
1134190077 16:12114244-12114266 CCAGAGGTACAGCTGCAAGTAGG + Intronic
1138302651 16:55945475-55945497 CCAGCAGCACAGCTGCAAATTGG + Intronic
1138659313 16:58508260-58508282 CCAGCAGCACAGCCCCAACTTGG + Intronic
1143285528 17:5786218-5786240 CCAGCAGAACTGCTGAACCATGG - Intronic
1143727127 17:8856661-8856683 ACACAAGTACAGGTGAAACTGGG - Intronic
1143837073 17:9701188-9701210 TCAGCAGCACAGCTGTACCTTGG + Exonic
1144508978 17:15858901-15858923 CCAGCAGTGCAGCTGACACAAGG + Intergenic
1145173094 17:20676541-20676563 CCAGCAGTGCAGCTGACACAAGG + Intergenic
1146008290 17:29176224-29176246 CCAGCAGTAAAGCTGCAAACAGG + Intronic
1146320166 17:31840668-31840690 GCAGCAGTACATCTGGAACATGG + Intergenic
1150594659 17:66593533-66593555 CCACATGCACAGCTGAAACTTGG + Intronic
1151276745 17:73040293-73040315 CCAGCAGCACAGCTAAAGTTGGG + Intronic
1151294943 17:73178172-73178194 CTGGCAGCACAGCTGAGACTAGG - Intergenic
1152250749 17:79211481-79211503 CCAGCAGCTCTGCTGAAACCTGG - Intronic
1154456223 18:14528626-14528648 CCAACAGCACAGCTGAAAGAGGG + Intronic
1155545375 18:26909152-26909174 CCAGCACTGAAGCAGAAACTTGG - Exonic
1156997162 18:43482323-43482345 CCAGCAGCACCGCTGCCACTGGG - Intergenic
1162195803 19:8983681-8983703 ATAGCAGAACAGCTGAAACTGGG - Intergenic
1168230551 19:55027900-55027922 CCAGCATCTCAGCTGAGACTGGG + Intronic
925957342 2:8980200-8980222 ACAGCAGTAGAGATGCAACTAGG + Intronic
926381626 2:12296321-12296343 CCTGCAGGGCAGCTGAAGCTAGG - Intergenic
926442279 2:12902476-12902498 ACAGCAGAATAACTGAAACTGGG + Intergenic
929421074 2:41790136-41790158 CCAGCAATGCAGTTGAAAATGGG + Intergenic
929961913 2:46503390-46503412 CCAGCAGGACTGCTAAACCTAGG - Intronic
930247229 2:48996672-48996694 TCAGCATGACAGCTGAAACGAGG + Intronic
933090661 2:78111970-78111992 CGAGCAGCACAGCTGCCACTGGG + Intergenic
935088258 2:99869402-99869424 CCAGCTCTACAGCTGACACATGG - Intronic
935700668 2:105809066-105809088 CCAGCTGTAGTGCTTAAACTGGG + Intronic
936405927 2:112202660-112202682 CAAGCAAAACAGCTGAATCTTGG + Intergenic
938335730 2:130494697-130494719 CCAACAGCACAGCTGAAAGAGGG + Intronic
938354091 2:130625967-130625989 CCAACAGCACAGCTGAAAGAGGG - Intronic
938741385 2:134235674-134235696 ACAGCAGTACAGCAGGATCTGGG - Intronic
942714259 2:178872918-178872940 CAAGCAGAACATCTGAAAGTTGG - Intronic
942984807 2:182127153-182127175 CCAGAAGTCCAGCTGAACTTTGG + Intronic
944996348 2:205298855-205298877 ACAGCAGAAAAGCTGGAACTAGG + Intronic
945073055 2:206010378-206010400 CAAGCAGTACAGCCAAAACCAGG + Intronic
945810736 2:214546905-214546927 TCAACAGTACTGCTGAAAGTAGG - Intronic
948270445 2:236669669-236669691 CCAGCAGTCCCCCTGAACCTTGG + Intergenic
948469984 2:238171251-238171273 GCAGGAGAACAGCTTAAACTGGG - Intronic
1170560781 20:17556639-17556661 CCAGTAGTAGAGCTTAAATTTGG + Intronic
1171097582 20:22346646-22346668 CCAGCAGGACAGATGACACCCGG + Intergenic
1172413637 20:34745461-34745483 GCAGCAGCATAGCTGAGACTGGG - Intronic
1173851693 20:46222639-46222661 CCAGGACAACAGCTGGAACTGGG - Intronic
1175075178 20:56366084-56366106 CCTGCAATCCTGCTGAAACTCGG + Exonic
1176817942 21:13624710-13624732 CCAACAGCACAGCTGAAAGAGGG - Intronic
1179826783 21:43970648-43970670 CTCGCAGTACAGGAGAAACTAGG - Exonic
1180475712 22:15704591-15704613 CCAACAGCACAGCTGAAAGAGGG - Intronic
1183034760 22:35133269-35133291 CCAGCACTCCTGCTGACACTGGG - Intergenic
1184340485 22:43883218-43883240 CCAGCTGCACAGCTCAATCTAGG - Intronic
1184790295 22:46695887-46695909 CCAGCAGGACAGCAGGGACTGGG + Intronic
1184860811 22:47172263-47172285 CCAGCAGTACAGCCAGCACTGGG - Intronic
1185043951 22:48519638-48519660 GAAGCAGCTCAGCTGAAACTGGG + Intronic
952142006 3:30490228-30490250 CCAGCTGCACAGCTGTACCTTGG - Intergenic
952646461 3:35664779-35664801 CCAAGAATACAGCTGAGACTTGG + Intronic
957748371 3:84375748-84375770 TCAGCACAACAGCTGAAAGTTGG - Intergenic
957760957 3:84555908-84555930 CCAGCAGAATTGGTGAAACTTGG + Intergenic
958587849 3:96114492-96114514 CCAGCAGCCCAGCAGACACTGGG - Intergenic
961005866 3:123405014-123405036 CCAGCAGCACTGGTGAAACAAGG - Intronic
964028878 3:152113213-152113235 AGAGCAGAACATCTGAAACTAGG + Intergenic
967903109 3:194477335-194477357 CCAGCAGTGCAGCTGAATAAAGG + Intronic
971292637 4:25359100-25359122 CAAGCAGCACAGCTGACAATGGG - Intronic
976333996 4:83864567-83864589 CCTGAAGTCCAGCTAAAACTAGG - Intergenic
976964816 4:91023908-91023930 AAAACAGAACAGCTGAAACTGGG + Intronic
978749337 4:112229337-112229359 CCCGCAGTTCAGCTAAAACCAGG - Intergenic
979174322 4:117643422-117643444 CCTGCAATAAAGCTGAAATTGGG + Intergenic
984349438 4:178571370-178571392 ACAACAGAACACCTGAAACTGGG + Intergenic
985145677 4:186892100-186892122 CCAGCTCTACAGCTGGAGCTTGG + Intergenic
987312771 5:16696760-16696782 CCAGAAGAATAGCTCAAACTTGG + Intronic
988288284 5:29250580-29250602 CCAGCAGAAAACCTGCAACTAGG - Intergenic
988541730 5:32116173-32116195 CCAGCAGGACAGCAGCAGCTGGG + Intergenic
990975155 5:61553594-61553616 GCAGCAACACAGCTGGAACTGGG - Intergenic
991432391 5:66561871-66561893 ACAGAAGAACACCTGAAACTGGG - Intergenic
992424831 5:76646212-76646234 CCAACAGCACAACAGAAACTAGG - Intronic
993966232 5:94364300-94364322 CAAGCAGAAGAGATGAAACTGGG + Intronic
994741230 5:103622014-103622036 CCAACAGGACAGCTAAAGCTGGG - Intergenic
995927148 5:117387436-117387458 CAAGAAGAACAGCTGAATCTTGG + Intergenic
996726694 5:126678910-126678932 GAAACAGTACATCTGAAACTGGG + Intergenic
1000621298 5:163489471-163489493 CCAGGACTAGAGCTGAAATTGGG + Intronic
1002979221 6:2118371-2118393 CCACCAGTAGAACTGGAACTTGG - Intronic
1004304360 6:14487142-14487164 CCAGGTCTACAGCTGCAACTTGG - Intergenic
1005927544 6:30456167-30456189 GCAGGAGTACAGCTTGAACTCGG + Intergenic
1006900553 6:37497958-37497980 ACAGTAGGACAGCTGAAACAAGG + Intronic
1012417527 6:99025998-99026020 CGACCAGCACAGCTGACACTGGG + Intergenic
1013388574 6:109658850-109658872 ACAGCAGAATACCTGAAACTGGG - Intronic
1014752122 6:125268331-125268353 CGAGCAGTACAGCTGCCACTGGG - Intronic
1016886874 6:148967301-148967323 AAAGCAGCACAGCAGAAACTCGG + Intronic
1017661808 6:156682229-156682251 CCACTAATACAGATGAAACTTGG + Intergenic
1017990839 6:159488666-159488688 CCAGATGTCCAGCTGACACTGGG - Intergenic
1018000332 6:159573038-159573060 ACAGCAATACAACAGAAACTTGG - Intergenic
1019098023 6:169602106-169602128 CCAACAGTCAAGCTGAAAGTAGG + Intronic
1020344715 7:7150422-7150444 CAATCAGTAAAGGTGAAACTTGG + Intergenic
1023404550 7:39819093-39819115 CCAACAGCACAGCTGAAAGAGGG - Intergenic
1024030159 7:45454148-45454170 CCAGCAGGACAGCTGGCAATGGG - Intergenic
1024293337 7:47822499-47822521 GCAGGAGAACAGCTCAAACTCGG + Intronic
1024987678 7:55209384-55209406 CCAGCAGTTCAGCTGGAAAGGGG + Exonic
1025141069 7:56465662-56465684 CAAGCTGTAAAGCAGAAACTTGG - Intergenic
1026104028 7:67407006-67407028 CCAGCAGTAGAGTTGAGTCTGGG + Intergenic
1027521341 7:79212597-79212619 GCAGCAGTAAAACTGTAACTGGG + Intronic
1032091530 7:128913967-128913989 CCAACAGTCCAGCTGCACCTTGG + Intergenic
1032708827 7:134444935-134444957 CTAGCAGTTCATCTGAAACTAGG - Intronic
1033653063 7:143356456-143356478 CCAGCAGTACAGCTGAAACTGGG - Exonic
1034366364 7:150551908-150551930 CCAGCAGTTCAGGAGGAACTAGG + Intergenic
1034450616 7:151135309-151135331 CCAGCAGGGCAGCTGTTACTGGG - Intronic
1034530763 7:151695053-151695075 CCAACAGCACATCGGAAACTTGG - Intronic
1037940242 8:22945776-22945798 CCTGCTTTACAGCTGAAGCTTGG + Intronic
1040408050 8:47128122-47128144 CCAACAGCACAGCTGAAAGAGGG + Intergenic
1041219204 8:55632351-55632373 CCAGCAGAACTGCTGACACAAGG + Intergenic
1044201807 8:89447027-89447049 CCAGCACAACAACAGAAACTAGG - Intergenic
1058785754 9:108385079-108385101 CTAGCAGAATAGGTGAAACTTGG + Intergenic
1061012811 9:127965470-127965492 CCAGGAGCACAGCTGGAACCTGG - Intronic
1062133118 9:134910872-134910894 CCAGCATCACTGCTGAAACCTGG - Intronic
1203529417 Un_GL000213v1:124793-124815 CCAACAGCACAGCTGAAAGAGGG + Intergenic
1186435538 X:9539869-9539891 TAGGCAGTACAGCTGAGACTTGG + Intronic
1186473343 X:9837952-9837974 TCAGCAGAACAGCTGGAATTGGG + Intronic
1189949103 X:46210430-46210452 CCAGAAGGACAGCTAAAAATGGG + Intergenic
1197045485 X:121992252-121992274 AGAGCAGTACAGCAGACACTGGG + Intergenic
1199709388 X:150458020-150458042 GCATCAGAGCAGCTGAAACTTGG - Intronic
1200857822 Y:7958604-7958626 CCAACACTACAGATGAAATTTGG - Intergenic