ID: 1033653872

View in Genome Browser
Species Human (GRCh38)
Location 7:143361193-143361215
Sequence GTGGTGAACCGGACTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 110}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033653872 Original CRISPR GTGGTGAACCGGACTGAGGA GGG Intronic
900743802 1:4346507-4346529 GGGGTGGACAGGGCTGAGGAAGG + Intergenic
902185856 1:14724846-14724868 TTGATGAACCAGAGTGAGGAAGG - Intronic
902991090 1:20187367-20187389 GTGGTGAAGTGAACTGAGCAGGG + Intronic
904619647 1:31767519-31767541 GTGGTGAACAGGGCTGAGTGAGG - Intergenic
905651180 1:39658032-39658054 GTGGGGAACGGGACAGAGCATGG - Intergenic
906214032 1:44028940-44028962 GTGATGAATCGGACTGGGTAGGG + Intronic
913528183 1:119713220-119713242 GTGGTGGACAGGGCTGAGGCGGG - Intronic
914342788 1:146774497-146774519 GCGGTAAGCCGGAGTGAGGAAGG - Intergenic
920874671 1:209822953-209822975 GTGGGGAACTGCACAGAGGATGG - Intergenic
922189944 1:223309494-223309516 GTGGTGCTCAGGACTGGGGAGGG + Intronic
923336112 1:232971611-232971633 GTGGTGAACGAGACTGACCAAGG + Intronic
1062934392 10:1375087-1375109 GTGGTGCATGGGACTCAGGAAGG + Intronic
1067474493 10:46556812-46556834 GTGGGGACCCGGCCTGAGGAGGG - Intergenic
1068037227 10:51776034-51776056 GTGGGGAAACCGACTGAGAAAGG - Intronic
1070484007 10:76912476-76912498 GAGGTGAAATGGTCTGAGGAGGG + Intronic
1073027057 10:100495749-100495771 GTGGAAAACCGGGATGAGGAAGG + Intronic
1076740212 10:132479149-132479171 GTGGTCACCCGGACCTAGGATGG - Intergenic
1077087342 11:760546-760568 GTGTTGATCAGGACAGAGGAAGG - Intronic
1083823701 11:65186626-65186648 CTGGTGAACTGGACAGAGGATGG - Intronic
1083969726 11:66067500-66067522 GTGGTGAAACTGGCTGTGGATGG + Exonic
1085178163 11:74508729-74508751 GTGGAGAACAGGCTTGAGGAAGG + Intronic
1087683312 11:101238153-101238175 GTGGGGATCCATACTGAGGATGG + Intergenic
1098303392 12:69077572-69077594 GTGGTGACCGGGGCTGGGGATGG + Intergenic
1101799824 12:108011508-108011530 GTGGTGAACAGGAGTGAGGAAGG - Intergenic
1104223211 12:126806249-126806271 GTGGTCACCAGGAGTGAGGAAGG - Intergenic
1104388532 12:128372066-128372088 GTGGTTGCCTGGACTGAGGATGG - Intronic
1105641407 13:22268845-22268867 GTGGGGAGCCAGACTGAGCAGGG + Intergenic
1106067500 13:26369500-26369522 GTGGTGCACTGAACTGAGGTTGG + Intronic
1108223646 13:48265222-48265244 TTGGGGAATGGGACTGAGGAAGG - Exonic
1113363351 13:109652311-109652333 GTGATGAAACAGACTGAGAAGGG - Intergenic
1114049658 14:18912910-18912932 GTGGTGCATCGACCTGAGGAAGG + Intergenic
1114112903 14:19489021-19489043 GTGGTGCATCGACCTGAGGAAGG - Intergenic
1114656074 14:24316366-24316388 GTGGTGAACCTGGCTGAGGCGGG + Exonic
1119740776 14:77012448-77012470 GTGGTGAAGCCGAAGGAGGAGGG - Intergenic
1124136172 15:27038107-27038129 GTGGCCAACCGGACTGAGATGGG - Intronic
1126075022 15:44900735-44900757 GTGGTGAAGCCTAGTGAGGATGG + Intergenic
1126083344 15:44987087-44987109 GTGGTGAAGCCTAGTGAGGATGG - Intergenic
1128797988 15:70478818-70478840 CTGGAGAACGGGACAGAGGAGGG + Intergenic
1130073556 15:80669400-80669422 GTGGTGATCAGGACCCAGGATGG + Intergenic
1134326814 16:13215059-13215081 GTGGTGACCTGCACTGAGGTGGG + Intronic
1135945415 16:26860625-26860647 GTGGTCAACAGGAATGAGGGAGG + Intergenic
1136030770 16:27501243-27501265 GTGCGGAACCTGTCTGAGGAAGG - Exonic
1136075037 16:27811482-27811504 GTGGTGTTCCGGGATGAGGAGGG - Intronic
1138578163 16:57922084-57922106 GTGGGCAACTGGACTGAGGGTGG + Intronic
1139905848 16:70365444-70365466 GGGATTAACAGGACTGAGGATGG + Intronic
1139991197 16:70940831-70940853 GCGGTAAGCCGGAGTGAGGAAGG + Intronic
1140048539 16:71459066-71459088 CTGTAGAACTGGACTGAGGATGG - Intronic
1141673304 16:85504187-85504209 TTGGTGAAGTGGGCTGAGGAGGG + Intergenic
1142364845 16:89644792-89644814 GGGGTGGGCAGGACTGAGGAGGG + Exonic
1142419886 16:89963684-89963706 GTGGTCAACCTGCCTGACGAGGG - Intronic
1144581077 17:16459942-16459964 GTGTTGAAGTGGTCTGAGGAAGG + Intronic
1144956867 17:19023073-19023095 GTGGTGAACAGGGAGGAGGATGG + Intronic
1147659165 17:42107981-42108003 GTGGTGAAGCTGAGTGAGGCTGG - Exonic
1159945889 18:74444703-74444725 GTCGAGAACCGGACTGGTGAAGG + Intronic
1160550898 18:79693202-79693224 GTGGTGACCGGGAGGGAGGATGG + Intronic
1160810216 19:1010052-1010074 GCAGTGAACCGTCCTGAGGATGG - Exonic
1162050005 19:8027409-8027431 GTGCTGAATGGGAATGAGGATGG - Intronic
1167110330 19:47456963-47456985 GTGGACTACCGCACTGAGGACGG - Exonic
1167418142 19:49387981-49388003 TTGGTGAAATGGGCTGAGGAAGG - Intergenic
1168561723 19:57390097-57390119 CTGATGAACCTGACTGAGGTGGG + Exonic
926126868 2:10277426-10277448 GTGGTGGACCAGATGGAGGACGG + Intergenic
926303340 2:11619059-11619081 GGGGTGGACCGGAGGGAGGAGGG + Intronic
926782631 2:16488272-16488294 GTGGAGGTCCGCACTGAGGAAGG + Intergenic
931925838 2:67071538-67071560 GTGGTGAAAGAGAGTGAGGAAGG - Intergenic
937264264 2:120606253-120606275 GTGATGAACCTGTCTGTGGATGG + Intergenic
938196652 2:129334528-129334550 GGGGTGAAACGGACAGTGGAGGG - Intergenic
938288574 2:130137647-130137669 GTGGTGCACCGACCTGAGGAAGG - Intergenic
938467958 2:131535287-131535309 GTGGTGCACCGACCTGAGGAAGG + Intergenic
938665502 2:133531155-133531177 ATGGTGAAAGGGAATGAGGAAGG + Intronic
942608328 2:177714979-177715001 GTGGGGAACCAGACACAGGAGGG - Intronic
946506942 2:220311961-220311983 GTGGAGGACTGGACAGAGGACGG - Intergenic
949017243 2:241720387-241720409 GTGGGGAACAGGCCTGAAGAGGG - Intronic
1169900459 20:10547425-10547447 GAGGTGAAAAGGACTCAGGAGGG - Intronic
1170460249 20:16571142-16571164 GAGGTGAACAGGTTTGAGGAAGG - Intronic
1171433855 20:25104302-25104324 GTGGTGGAAAGGACAGAGGAGGG - Intergenic
1172612544 20:36262586-36262608 CTGGTGCTCCAGACTGAGGAAGG - Intronic
1173885762 20:46457636-46457658 ATGGCGAGCTGGACTGAGGATGG - Intergenic
1173885765 20:46457655-46457677 GAGGTGAGCTGGGCTGAGGATGG - Intergenic
1180468137 22:15635285-15635307 GTGGTGCATCGACCTGAGGAAGG + Intergenic
1184493553 22:44824374-44824396 GTGGTGCACTGGACTGAGCCTGG - Intronic
949438230 3:4051868-4051890 GTGGTAAACCGGTCTGAGTAAGG + Intronic
950265875 3:11572522-11572544 GAGGGGAATGGGACTGAGGAGGG - Intronic
953546299 3:43865981-43866003 GTGGTAAACAGGACTTAGGCCGG + Intergenic
954428711 3:50457857-50457879 GTGATGATGGGGACTGAGGAGGG + Intronic
956888782 3:73588531-73588553 GTGGGAAACAGGACTGAGGAGGG - Intronic
959498928 3:107082933-107082955 GTGGTGAACCTGACAGAGCCTGG + Intergenic
961001999 3:123380259-123380281 GTGGTGAACAGGCTTGAGTAGGG + Intronic
963736092 3:149019392-149019414 GAGGTGAGCAGGACTGTGGAGGG - Intronic
977313167 4:95412243-95412265 GTGGTGAAGAGGATTGAGAAGGG - Intronic
978760415 4:112351270-112351292 GCAGTGAACTGGACAGAGGAGGG + Intronic
980532169 4:134070408-134070430 GTGGTGAACTGGCCTGTGCAAGG + Intergenic
983377222 4:166945631-166945653 GTGGTCAATTGGAGTGAGGAGGG - Intronic
996729710 5:126705282-126705304 TTGGTGAACTGAACTGAGGAAGG - Intergenic
998199612 5:140108656-140108678 GGGGGGAACCGAACAGAGGAGGG - Intronic
1001008330 5:168074627-168074649 GTGGTTAACCAGACTGCAGAGGG - Intronic
1001932161 5:175680916-175680938 GTGTTGAAAAGGACTGAGGAAGG + Intronic
1006640257 6:35485975-35485997 GTGGGGAAGGGGACTGAGGAGGG + Intronic
1006973919 6:38078703-38078725 GTGTTGACCGGGACTGAGGTTGG - Intronic
1007278499 6:40693014-40693036 GTGGTGAACTGAACTGAGATGGG - Intergenic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1023754335 7:43402064-43402086 GTGGTGAGCTGGAAAGAGGATGG - Intronic
1026525512 7:71150109-71150131 ATGGTGAACAGGAATGAGAAGGG - Intronic
1032621899 7:133542626-133542648 GGGGAGAATAGGACTGAGGAGGG + Intronic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1035409007 7:158623512-158623534 GTGGTGAGCCTCAGTGAGGAGGG - Intergenic
1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG + Intergenic
1039967906 8:42297100-42297122 GATGTGAACAGGTCTGAGGAAGG - Intronic
1045344204 8:101280106-101280128 GTGGTGATCTGGACTGCGGTGGG + Intergenic
1045932760 8:107646446-107646468 GTGCCCACCCGGACTGAGGATGG + Intergenic
1049309835 8:141927995-141928017 GGGCTGAGCTGGACTGAGGACGG - Intergenic
1052691842 9:31825238-31825260 TTGGTGAAAGGGACTGTGGAGGG + Intergenic
1058424839 9:104867223-104867245 GTGGGGAACAGGAGAGAGGAAGG + Intronic
1060371594 9:123078608-123078630 GTGCTGAACCAGGCTGAGGTGGG - Intronic
1061201010 9:129138586-129138608 GTCGGGAAAGGGACTGAGGAGGG - Intronic
1186424933 X:9456460-9456482 GTGCTCACCCGCACTGAGGAGGG + Intergenic
1186608048 X:11111684-11111706 GTGGTGACCCGGGTGGAGGAGGG - Intronic
1186964510 X:14772800-14772822 CTGGTGGCCTGGACTGAGGAGGG + Intergenic
1188624761 X:32269624-32269646 ATGGTGAGCCGGAATGAGTAAGG - Intronic
1192150421 X:68708899-68708921 CAGGTGGCCCGGACTGAGGATGG - Intronic
1196748154 X:119090061-119090083 GTGGGGAAACTGACTGGGGAAGG + Intronic
1199656432 X:149999616-149999638 GTGCTGAACAGGTCAGAGGAAGG - Intergenic
1199995397 X:153021598-153021620 GTGGTGAACAGGAGGGAGGAGGG - Intergenic
1201496425 Y:14594886-14594908 GTGGGGATCCGTACTGGGGATGG + Intronic