ID: 1033654364

View in Genome Browser
Species Human (GRCh38)
Location 7:143362808-143362830
Sequence GGCCGCGGCGAGCCGAGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 250}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033654364_1033654377 -4 Left 1033654364 7:143362808-143362830 CCCCGGCTCGGCTCGCCGCGGCC 0: 1
1: 0
2: 3
3: 40
4: 250
Right 1033654377 7:143362827-143362849 GGCCGGGGAGGGGGCGGCCCGGG 0: 1
1: 2
2: 13
3: 218
4: 1577
1033654364_1033654380 2 Left 1033654364 7:143362808-143362830 CCCCGGCTCGGCTCGCCGCGGCC 0: 1
1: 0
2: 3
3: 40
4: 250
Right 1033654380 7:143362833-143362855 GGAGGGGGCGGCCCGGGGATTGG 0: 1
1: 0
2: 4
3: 55
4: 565
1033654364_1033654376 -5 Left 1033654364 7:143362808-143362830 CCCCGGCTCGGCTCGCCGCGGCC 0: 1
1: 0
2: 3
3: 40
4: 250
Right 1033654376 7:143362826-143362848 CGGCCGGGGAGGGGGCGGCCCGG 0: 1
1: 1
2: 15
3: 138
4: 1203
1033654364_1033654378 -3 Left 1033654364 7:143362808-143362830 CCCCGGCTCGGCTCGCCGCGGCC 0: 1
1: 0
2: 3
3: 40
4: 250
Right 1033654378 7:143362828-143362850 GCCGGGGAGGGGGCGGCCCGGGG 0: 1
1: 0
2: 14
3: 141
4: 983
1033654364_1033654374 -10 Left 1033654364 7:143362808-143362830 CCCCGGCTCGGCTCGCCGCGGCC 0: 1
1: 0
2: 3
3: 40
4: 250
Right 1033654374 7:143362821-143362843 CGCCGCGGCCGGGGAGGGGGCGG 0: 1
1: 3
2: 11
3: 157
4: 1257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033654364 Original CRISPR GGCCGCGGCGAGCCGAGCCG GGG (reversed) Intergenic
900201290 1:1407780-1407802 GGCCGCGGCGAGCCGAGGTCGGG - Intergenic
900633507 1:3651093-3651115 GTCCGCGGGGAGCAGACCCGAGG - Intronic
901280036 1:8026599-8026621 GCCCGCGGCGACCCGGGCCTCGG + Intergenic
901540071 1:9910035-9910057 GCCCGCGCCGCGCCGCGCCGGGG - Intronic
901628846 1:10638620-10638642 GGCCGCGGGGAGGGGCGCCGGGG + Exonic
901641322 1:10694534-10694556 GGCCGGCGCGGGCCGGGCCGAGG - Intronic
902920679 1:19664800-19664822 GGGCGGGGAGAGCCGAGCCCTGG - Intergenic
903925177 1:26826767-26826789 GCCCGCGGGGCGCGGAGCCGAGG + Exonic
904044898 1:27603214-27603236 AGCCGAGCCCAGCCGAGCCGCGG + Intronic
904190174 1:28737225-28737247 GGGCAGGCCGAGCCGAGCCGAGG + Intronic
904500083 1:30908405-30908427 GGCCCCGGGGAGCCGTGGCGGGG + Intronic
909585317 1:77282247-77282269 GGCTGCGGCGACCTGAGCCGGGG - Exonic
912576340 1:110675263-110675285 GGACGCGGCCAGGCGGGCCGGGG - Intergenic
912798617 1:112707211-112707233 GGCCGGGGCGGGCCGAGCCAAGG - Intronic
913144508 1:115976473-115976495 GGCCGGGGCGGGCCGGGCCGGGG - Intergenic
914386871 1:147178163-147178185 GGCAGCCGCGAGGCGGGCCGCGG - Intronic
914702903 1:150150222-150150244 GGGCGCGGGGCGGCGAGCCGAGG - Exonic
915161258 1:153922515-153922537 GGCGGGGGCGCGCCGTGCCGGGG + Intronic
917291604 1:173477231-173477253 GGCCGCTGGGGGCCGGGCCGCGG - Intergenic
917974352 1:180229761-180229783 GGCGGGGCGGAGCCGAGCCGGGG - Intergenic
918487560 1:185045611-185045633 GGCCGCGGCCAGCGGAGCCCTGG + Exonic
919763517 1:201112536-201112558 GGCAGCGGGGAGCCGAGTGGAGG - Exonic
919822862 1:201483888-201483910 GGCTGCGGCCAGCAGAGCCCAGG - Exonic
920528595 1:206685615-206685637 GGCCGCGGCGGGGCGGGGCGGGG + Intronic
922766159 1:228157674-228157696 GCCCGCGGCGCTCAGAGCCGGGG - Intronic
1065025097 10:21534098-21534120 GGCGGCGGCGAGCGGCGCGGGGG + Intergenic
1067344490 10:45427783-45427805 GGCCGCTGCGAGCCGCGCAGTGG - Intronic
1067436899 10:46284792-46284814 GGCTCCGGGGAGCTGAGCCGGGG - Intergenic
1069849784 10:71397274-71397296 GCCCGAGGCGAGGCGAGGCGCGG + Intronic
1070610144 10:77927034-77927056 GGCCCCGGTGAGCCGGGCCGGGG - Intergenic
1071532434 10:86400481-86400503 GGCGGCGGCGAGCCGAGACCAGG - Intergenic
1072710648 10:97713832-97713854 GGCGGCGGCGCCCCGAGCAGCGG - Exonic
1073249794 10:102114582-102114604 GGCCGCCGCGGGGCGGGCCGAGG - Intronic
1074546391 10:114404720-114404742 GGGGGCGGCGAGCGGGGCCGCGG - Intronic
1074591887 10:114821747-114821769 GGCCGCGGCGGGCAGAGCGGGGG + Exonic
1076189203 10:128470770-128470792 GGCTGCGGCTGGCTGAGCCGGGG + Intergenic
1076554181 10:131311438-131311460 GGCCGAGGCGAGCAGCACCGGGG + Exonic
1076722057 10:132397071-132397093 AGCCGAGCCGAGCCGGGCCGGGG - Intergenic
1076722211 10:132397573-132397595 GGCCGGGGCGGGCCGGGGCGGGG + Intronic
1078210339 11:9265176-9265198 GGGGGCGGCGGCCCGAGCCGCGG - Exonic
1080037261 11:27722527-27722549 AGCCGCGGAGAGCGGAGCCGCGG + Intergenic
1080601937 11:33829203-33829225 GGTCACCGCGAGCCGAGCTGGGG - Intergenic
1081493356 11:43583346-43583368 GGCTGAGGCGAGGCGAGGCGAGG - Intronic
1082816864 11:57514951-57514973 GGCCGCGGCGGGGGGAGCTGGGG - Intronic
1083572796 11:63769079-63769101 GGTGGCCGCGAGCCGAGCCCGGG - Intergenic
1083747706 11:64744848-64744870 GGCGGCGGGGAGCGGGGCCGCGG - Intronic
1084146187 11:67266543-67266565 AGCGGCGGCGAGCGGAGCCGCGG + Exonic
1084165406 11:67372941-67372963 GGACGGGCCGAGCCGCGCCGCGG - Intronic
1084295924 11:68213415-68213437 GGGCGCAGCGAGCCGAGGCCGGG - Exonic
1084315443 11:68342921-68342943 GGCCCTGGCCAGCCCAGCCGAGG - Intronic
1084695941 11:70755673-70755695 AGCCGCGGGGTGCGGAGCCGAGG - Intronic
1086322372 11:85664490-85664512 GGCCCCGGCGAGCTAAGCCCGGG + Exonic
1086337156 11:85811249-85811271 GGCCGGGGCGGGCCGGGGCGGGG - Intergenic
1087288685 11:96296407-96296429 GGCAGAGGCGAGCGGATCCGAGG + Intronic
1088823480 11:113475285-113475307 GGCCGCGGCGGGGCGGGGCGGGG + Exonic
1089243131 11:117098440-117098462 GGCCGCGGGGAGCCGGCTCGGGG + Intergenic
1090662347 11:128891175-128891197 GGCCGCGGGGACGCGAGCGGAGG + Intergenic
1090758626 11:129816177-129816199 GGCCGCGGCCAGCCGGACAGAGG - Intronic
1092219129 12:6700792-6700814 AGCCGAGCCGAGCCGAGCCGAGG - Intronic
1095261679 12:40105697-40105719 GGACGCGGCGAGCGCGGCCGGGG - Exonic
1095703654 12:45216159-45216181 CGCCGGGGAAAGCCGAGCCGAGG - Exonic
1095752871 12:45729948-45729970 GGCAGCGCCGGGGCGAGCCGGGG + Intronic
1097155092 12:57006520-57006542 CGTCGCGGCGAGCCGCGCGGCGG - Intergenic
1097237007 12:57547064-57547086 GGCGGCGGCGAGACGGGCTGGGG + Exonic
1098161031 12:67648632-67648654 GGCCGCGGCCGGGGGAGCCGGGG + Intronic
1098255353 12:68610788-68610810 GGGCGGGGCGAGGGGAGCCGAGG - Intergenic
1102498436 12:113335157-113335179 GACCGGGGCGGGGCGAGCCGGGG - Intronic
1103488175 12:121296676-121296698 AGCCGAGCCGAGCCGAGCTGGGG - Intronic
1104602478 12:130162772-130162794 GGGCGCGGAGAGCCGAGCCGGGG + Exonic
1104981472 12:132574809-132574831 GGCCACGGGGAGCAGAGCAGGGG + Intronic
1105564493 13:21530803-21530825 GGCCGAGGCCAGGCAAGCCGTGG + Intronic
1105577945 13:21670445-21670467 GGCCGCCGGGACCCGAGCAGCGG + Intergenic
1105943409 13:25170693-25170715 GGCATCGGCGCGCCGAGCCGGGG - Exonic
1105964579 13:25372495-25372517 GGCCGGGGCGAGGTGAGCGGCGG + Intronic
1107412654 13:40172280-40172302 GGCCGCGGCAGGAAGAGCCGCGG - Intergenic
1107804614 13:44142132-44142154 AGCCGAGCCGAGCCGAGCCGAGG - Intergenic
1108518272 13:51222573-51222595 AGCCGCGCCGGGCCGGGCCGCGG + Intronic
1108689152 13:52846801-52846823 GGCCGAGGTGGGCCGCGCCGGGG - Exonic
1108727913 13:53201616-53201638 GGCCGAGGTGGGCCGCGCCGGGG + Intergenic
1112733671 13:102394640-102394662 GCCCCCGGCGAGCCGAGGCTGGG + Intronic
1113541943 13:111115723-111115745 GGCCGCAGCGGGCCGGACCGGGG - Intronic
1114633273 14:24172939-24172961 GGCCGCGGCAGGCCGGGCTGCGG - Exonic
1116657929 14:47674751-47674773 GGCGGCGGCGAGCGGAGCGCAGG + Exonic
1116817849 14:49599754-49599776 GGGCGCGGCGACCGGGGCCGGGG + Intronic
1117375319 14:55113728-55113750 GGCTGCGGTGAGCCGTGCCACGG - Intergenic
1117478214 14:56118440-56118462 GGCCGCGGCGCGCGGAGCTCCGG + Exonic
1117680680 14:58200076-58200098 GGCCGCGGCGCGCCGGGCCCGGG - Intronic
1118030318 14:61812512-61812534 GGACGCGGCGAGGCGAGGAGGGG + Intergenic
1120809961 14:88792954-88792976 AGCCGAGCCGAGCCGAGCGGCGG + Intergenic
1120881281 14:89416983-89417005 GGGCGCGGCGCGGCGAGCCCGGG + Intronic
1120881346 14:89417158-89417180 CGCCGCGGCGCGTCGGGCCGGGG + Intronic
1121535721 14:94689608-94689630 GGCCCCGGCCAGCCGCGCCCAGG - Intergenic
1121754506 14:96391874-96391896 GGGCGGGGCGAGTCGTGCCGGGG - Intergenic
1122220957 14:100238977-100238999 GGTTGCGGCGAGGCGAGGCGAGG + Exonic
1122265898 14:100546675-100546697 GGCGGCGGCGGGCCGGGCCGCGG + Intronic
1122978692 14:105181503-105181525 GGGCGGGGCCAGCCGGGCCGGGG + Intergenic
1123442334 15:20301482-20301504 TCCCGCAGCGAGGCGAGCCGTGG - Intergenic
1124109590 15:26773341-26773363 GGACGCTGCGAGCGGAGCCGCGG + Intronic
1124453856 15:29822523-29822545 GGACGAGGCGAGGCGAGGCGAGG + Intronic
1124564789 15:30803162-30803184 GGCTGCGGGGAGCCGAGACCGGG + Intergenic
1124696747 15:31870304-31870326 CGCGCCGGCGAGCCCAGCCGGGG + Intronic
1125606376 15:40941964-40941986 GGCCGCGGGAAGCGGAGCCGCGG + Intergenic
1125937478 15:43649172-43649194 GGCAGCGGCGAGGCGGGCCGCGG - Intronic
1125950384 15:43746589-43746611 GGCAGCGGCGAGGCGGGCCGCGG - Exonic
1127221758 15:56887469-56887491 GGCCGCAAAGAGCGGAGCCGGGG - Intronic
1129082269 15:73052030-73052052 GGCGGGGGCGCGCGGAGCCGAGG + Intronic
1131144283 15:90001552-90001574 GGCCGGGCCGGGCCGGGCCGGGG - Exonic
1131263580 15:90902825-90902847 GGCAGCGGCGCGCGGAGCAGGGG + Intronic
1132055616 15:98648787-98648809 AGCCGAGGCGAGGCGCGCCGTGG - Intergenic
1132480673 16:164889-164911 GGGCGGGGCGGGCCGGGCCGGGG + Intronic
1132586021 16:706035-706057 GCCCGCGGCGAGCGGGGCGGGGG - Intronic
1132837057 16:1959451-1959473 GGCCGCGCCCGGCGGAGCCGGGG + Intergenic
1133220120 16:4316182-4316204 GGGCGCGGGGAGCCGAGCGGGGG - Intronic
1134070173 16:11255820-11255842 GGGCGCGGGGCGGCGAGCCGGGG - Intronic
1135517555 16:23148720-23148742 GGCCGCGGCGCGCAGGGCCAGGG - Exonic
1135607327 16:23836014-23836036 GGCCGCGGCGCGCGGAGCCGGGG - Exonic
1135745854 16:25015463-25015485 AGCCGAGTCGAACCGAGCCGAGG + Intronic
1136365372 16:29806906-29806928 GGCCGCGGCGGCCCGGGCTGGGG + Intronic
1138178738 16:54928881-54928903 GGCTGCGGCGGGCGGAGCCGGGG + Intergenic
1138561324 16:57802409-57802431 GGCCGGGCCGGGCCGAGCCCCGG - Exonic
1141582748 16:85011413-85011435 GACCAAGCCGAGCCGAGCCGCGG - Exonic
1141901411 16:86993592-86993614 GGCTGCGGCGAGGCCAGCTGAGG - Intergenic
1142623733 17:1179941-1179963 GGCCGCGCCGAGCCCAGCTGCGG + Intronic
1143116634 17:4584993-4585015 GGCCGCGGCCAGGTGAGCCCGGG + Exonic
1143443729 17:6995559-6995581 GGCCGCGCCGGGTCTAGCCGCGG + Intronic
1144586839 17:16492230-16492252 GGGCGGGCCGAGCCGGGCCGGGG - Intergenic
1145815745 17:27793784-27793806 GGGCGGGGCGAGCCGAGCAGCGG + Intronic
1146652829 17:34616925-34616947 GGGCTTGGCGAGCAGAGCCGGGG + Intronic
1146763510 17:35498174-35498196 GGCGGCGGCGTGGGGAGCCGGGG + Intronic
1147720469 17:42536607-42536629 GGCCACTGCCAGCCGTGCCGGGG + Exonic
1148205302 17:45775962-45775984 GGCAGCGCAGAGCCGAGCCCGGG - Intergenic
1148206722 17:45784227-45784249 GGGGGCGGGGAGCCGAGGCGAGG + Intergenic
1148206770 17:45784366-45784388 GGCCGGGCCGGGCCGGGCCGCGG + Intronic
1148493438 17:48037711-48037733 GGCCGCGGCGGCCCAGGCCGGGG - Exonic
1148684771 17:49495289-49495311 AGCCAGAGCGAGCCGAGCCGCGG + Exonic
1150168444 17:62966496-62966518 GCCGCCGCCGAGCCGAGCCGAGG + Intergenic
1150488771 17:65560892-65560914 TGCCGCCGCGAGCCGAGCCGGGG - Intronic
1150488923 17:65561362-65561384 GGTCGCGCCGAGCCGCGGCGTGG - Intronic
1151707754 17:75779572-75779594 GGCCGTTGGGAGCCGAGCGGCGG - Intronic
1152110076 17:78353050-78353072 GGCCGCGGCGATGCGGGCCCGGG + Intergenic
1152422911 17:80203747-80203769 GGCAGGGGAGAGCCGAGCAGGGG - Intronic
1152593168 17:81223388-81223410 GGTGTCGGGGAGCCGAGCCGAGG - Intergenic
1152648559 17:81481578-81481600 GGCTGCGGCGGGCCGGCCCGGGG + Intergenic
1152744219 17:82031715-82031737 CGCGGCCGCGAGCCGAGCTGCGG - Exonic
1152853006 17:82648611-82648633 GGGCGGGGCGAGGCGAGGCGAGG + Intergenic
1152853007 17:82648616-82648638 GGGCGAGGCGAGGCGAGGCGAGG + Intergenic
1153872707 18:9335011-9335033 GGCCGCGGCGAGCTTCGCGGGGG + Intronic
1154940809 18:21111444-21111466 GGCCGGGCCGAGTAGAGCCGGGG - Exonic
1156350572 18:36298089-36298111 GGCCGCGCCCAGCCCAGCCCAGG - Intronic
1157222762 18:45839119-45839141 GGCCGCGAGGGGCCGGGCCGGGG + Intronic
1159798267 18:72868320-72868342 CGCCCTGGCGGGCCGAGCCGCGG - Intergenic
1160121116 18:76131160-76131182 GGCCGGAGCGAGCAGAGCCTTGG - Intergenic
1160594486 18:79964472-79964494 TCCCGAGCCGAGCCGAGCCGAGG - Intergenic
1160897243 19:1408451-1408473 GCACGTGGCGAGCCGAGGCGAGG + Intronic
1161264785 19:3359317-3359339 CTCCGCAGCGAGCCCAGCCGGGG + Intergenic
1161401170 19:4066694-4066716 GGCCGGGGCGCGCGGGGCCGGGG + Exonic
1161479150 19:4501995-4502017 GGACGAGGAGAGCTGAGCCGCGG + Exonic
1161959558 19:7516214-7516236 GGGCGCGGCGGGCCGGGCAGGGG + Exonic
1162778702 19:12995784-12995806 GGCCGCGGCGAGGGGAGGCCCGG - Exonic
1163450933 19:17377084-17377106 GGCCACCGAGCGCCGAGCCGAGG - Exonic
1165420096 19:35718182-35718204 GGCCGGGCGGAGCCGAGCCCGGG + Exonic
1166043875 19:40218246-40218268 GACCGGGACGAGCCGAGCCATGG + Exonic
1166538782 19:43592457-43592479 GGCTGCGGCGTTGCGAGCCGGGG - Exonic
1168350949 19:55675258-55675280 GGGCGCGGAGAGCCGGGCGGGGG - Intronic
924985130 2:263996-264018 GGCCGCGGCGCCCCGTCCCGAGG + Exonic
926801839 2:16665912-16665934 GGCTGCCGCGAGCCGGGCTGGGG - Intronic
927692171 2:25216050-25216072 CACCCCGGCGAGCAGAGCCGCGG + Intergenic
927935114 2:27071899-27071921 GGACGCGGCTAGCGAAGCCGTGG + Intergenic
929501168 2:42493074-42493096 GGCCGCGACGAGGCGCGCCCCGG - Exonic
929966834 2:46542810-46542832 GGGCGCGGCGACCGGGGCCGGGG + Exonic
930798703 2:55420064-55420086 GGCGGCGGCGAGGCTAGCCCGGG - Intergenic
931681134 2:64750843-64750865 GGCCGCGGCGGGGCGAGCGGCGG + Intronic
934460518 2:94211916-94211938 ACCCGCAGCGAGGCGAGCCGTGG - Intergenic
938455590 2:131460759-131460781 GGGCGCGGCGACCGGGGCCGGGG + Intergenic
938469110 2:131543745-131543767 AACCGCAGCGAGGCGAGCCGGGG - Intergenic
939612929 2:144332285-144332307 GGCTGCGGCGCGGGGAGCCGGGG - Intronic
943645969 2:190408322-190408344 GGGCGCGGCGAGGCGAGGCGAGG - Intergenic
947860588 2:233354761-233354783 GGCCGGGCCGAGCCGGGCCTGGG - Intronic
1170524760 20:17226843-17226865 GGCCGGGCCGGGCCGGGCCGGGG + Intronic
1170578722 20:17682376-17682398 GGACGCGGGTGGCCGAGCCGCGG + Intergenic
1172702931 20:36863689-36863711 GGCTGCGCCGGGCGGAGCCGGGG - Intergenic
1174054040 20:47785775-47785797 GGGCGCGGGGGGCCCAGCCGCGG + Intronic
1175715504 20:61252411-61252433 GGCGGCGGCGATCGGAGCGGCGG + Exonic
1176044838 20:63087178-63087200 GGCCGGGGTGAGCCCAGCTGTGG + Intergenic
1176221143 20:63969836-63969858 GGCCGGGCCGGGCCGGGCCGGGG + Intronic
1176242195 20:64080212-64080234 GGCCCCGCCGAGCAGAGTCGGGG - Intronic
1176380722 21:6111069-6111091 GGCCGGGGCGGGCCGGGGCGGGG + Intergenic
1176549014 21:8213569-8213591 GGCCGCGCCGCGCCGCGCCGGGG + Intergenic
1176551772 21:8226189-8226211 GGGCGGGGCGAGGCGAGGCGAGG + Intergenic
1176556905 21:8257783-8257805 GGCCGCGCCGCGCCGCGCCGGGG + Intergenic
1176567943 21:8396601-8396623 GGCCGCGCCGCGCCGCGCCGGGG + Intergenic
1176570681 21:8409188-8409210 GGGCGGGGCGAGGCGAGGCGAGG + Intergenic
1176575847 21:8440820-8440842 GGCCGCGCCGCGCCGCGCCGGGG + Intergenic
1176578590 21:8453335-8453357 GGGCGGGGCGAGGCGAGGCGAGG + Intergenic
1178707639 21:34888810-34888832 GGCGGCGGCGAGCCGCGCCCTGG - Intronic
1179639571 21:42738484-42738506 GGTCGGGGAGAGCTGAGCCGAGG - Intronic
1179742750 21:43427171-43427193 GGCCGGGGCGGGCCGGGGCGGGG - Intergenic
1181574813 22:23787087-23787109 GGCCGGGGCGTGCTGGGCCGAGG - Exonic
1183519786 22:38290226-38290248 GGCAGAGGCAAGACGAGCCGAGG - Intergenic
1183931760 22:41239539-41239561 GGCGGCGGCCTGCCTAGCCGGGG + Exonic
1184101595 22:42343994-42344016 GGCCGCGGCGCGCCGGGCTGGGG + Intergenic
1184557432 22:45240916-45240938 GGGCGGGGCGAGCGGAGCCGGGG - Intergenic
1184673358 22:46027379-46027401 GGCCGCGCCCCGCCGCGCCGGGG + Intergenic
1203253898 22_KI270733v1_random:129878-129900 GGCCGCGCCGCGCCGCGCCGGGG + Intergenic
1203256794 22_KI270733v1_random:143111-143133 GGGCGGGGCGAGGCGAGGCGAGG + Intergenic
1203261954 22_KI270733v1_random:174957-174979 GGCCGCGCCGCGCCGCGCCGGGG + Intergenic
950434067 3:12967936-12967958 GGCGGGGCCGAGCCGAGGCGCGG + Intronic
951208377 3:19947495-19947517 GACCGCAGCAAGCCGAGCTGCGG - Exonic
954156138 3:48685869-48685891 GGGAGCGCCGAGCCGCGCCGCGG + Exonic
954384288 3:50236270-50236292 GGCGGGGCCGAGCCGGGCCGTGG + Exonic
954468864 3:50674932-50674954 CGCTGGGGCGAGCCGAGCCGCGG + Intergenic
955281334 3:57597400-57597422 GGCCGCGGCGACTCCAGCAGCGG + Exonic
955916486 3:63912649-63912671 GGCGGCGGCGGGCGGAGCAGCGG + Exonic
956179132 3:66501095-66501117 GGCCGCGGAGCGCGGAGCCTAGG - Intronic
960224009 3:115148077-115148099 TGGCGCGGCGAGCTGCGCCGGGG + Intergenic
960664482 3:120095614-120095636 GGCCGCGCCCCGCCCAGCCGCGG + Intergenic
961359361 3:126357332-126357354 GGCGGCCGGGGGCCGAGCCGCGG + Exonic
961754860 3:129121683-129121705 GGCGGGGCCGAGCCGGGCCGGGG - Exonic
963091408 3:141486953-141486975 GGGCGGGGCGAGTCGGGCCGAGG + Intergenic
964482800 3:157159636-157159658 GGCCGGGGCGTGCCGGGGCGGGG - Intronic
964720419 3:159763958-159763980 GGCCGGGCCGGGCCGGGCCGGGG + Intronic
965648346 3:170908348-170908370 GGCCGGGCCGAGCTGAGCCCTGG - Intronic
969053288 4:4387188-4387210 GGCCTCGGCAAGCCCAGGCGCGG - Intronic
969413378 4:7043540-7043562 GGCTGCGGCGGGCCGGGCGGCGG + Exonic
978511804 4:109528361-109528383 GGTTGCAGTGAGCCGAGCCGAGG + Intronic
983296336 4:165873526-165873548 GGGCGCCGCTCGCCGAGCCGCGG + Exonic
983792241 4:171813059-171813081 GAGCGCGGCGAGCCGGGGCGCGG - Intronic
985064148 4:186104995-186105017 GGCCGAGGCGGCCCGGGCCGGGG - Intronic
988595381 5:32585841-32585863 GTCCCCGGGGAGCCGAGTCGAGG + Intronic
997120796 5:131171002-131171024 GGCCGCGGTGAGGAGAGCCATGG + Exonic
998157752 5:139796026-139796048 GGCCGGGGCGGGACGGGCCGGGG + Intronic
1000014559 5:157266061-157266083 AGCCGCGGCGGGCGGAGCAGCGG + Exonic
1002591217 5:180292436-180292458 GTCCGCGGGGAGCCGGGCCTCGG + Intergenic
1005473927 6:26188950-26188972 CGCCGCGGCGAGCCAGGCGGCGG + Exonic
1006334037 6:33411180-33411202 GGCCGCCGGGAGCCGGGCAGGGG - Exonic
1007082146 6:39115153-39115175 GGCCGGCGCGGGCCGAGCGGAGG - Exonic
1010044000 6:71420195-71420217 GGCCGCGTCGCGCCGCCCCGCGG + Intergenic
1011496391 6:87940781-87940803 GGTTGCAGTGAGCCGAGCCGAGG + Intergenic
1011517202 6:88166821-88166843 GGCCGAGGCGCGCCGGGCCCGGG + Intergenic
1013155750 6:107490073-107490095 GCCTCCCGCGAGCCGAGCCGGGG - Exonic
1013538702 6:111087380-111087402 GGCCTCGGAGAGCGGAGGCGGGG - Intergenic
1015750091 6:136550449-136550471 GGCCGGCGGGAGCCAAGCCGAGG - Intronic
1020080501 7:5283569-5283591 AGGCGCGGCGACCCGGGCCGGGG + Intronic
1021106559 7:16645461-16645483 GGCCGCGGCCAGCCTGGCCGGGG - Intronic
1023846389 7:44123383-44123405 TGCCGCGTGGATCCGAGCCGGGG - Exonic
1025198416 7:56948610-56948632 AGGCGCGGCGACCCGGGCCGGGG - Intergenic
1025673535 7:63628323-63628345 AGGCGCGGCGACCCGGGCCGGGG + Intergenic
1026909450 7:74083864-74083886 GGCCGGGCCGGGCCGGGCCGGGG - Intronic
1027829791 7:83162850-83162872 CGCCTCGGCGCCCCGAGCCGGGG + Exonic
1028160099 7:87475693-87475715 GGCCGCGGCGAGCAAAGTCCAGG - Exonic
1031986285 7:128166675-128166697 GGAGGCGGCGCGCGGAGCCGCGG - Intergenic
1032525658 7:132576986-132577008 GCCCGCGGCCGGCCGCGCCGCGG + Exonic
1033328474 7:140398446-140398468 TGACCCGGCGAGCGGAGCCGGGG - Exonic
1033654364 7:143362808-143362830 GGCCGCGGCGAGCCGAGCCGGGG - Intergenic
1034253909 7:149714376-149714398 GGCTGCGGCGAGCGGGGGCGCGG + Intergenic
1034264282 7:149773602-149773624 GGCCGCGGAGGGAGGAGCCGGGG + Intergenic
1035020191 7:155796412-155796434 GGCCGAGGGGCGCCGAGCCCTGG - Intergenic
1035020416 7:155797256-155797278 GGCCGGGGGGAGCCGGGTCGGGG - Intergenic
1035169603 7:157010193-157010215 GGCGGCGGCGGGGCGAGCGGCGG - Exonic
1035579382 8:730858-730880 GGCGGAGGCGAGCCCAGCCAGGG - Intronic
1036723623 8:11200682-11200704 GGCCACCGCGGGCCGCGCCGTGG + Exonic
1037788878 8:21919591-21919613 GGCCCCGGCGGCCCGGGCCGTGG - Intergenic
1041292397 8:56319924-56319946 GGGCGCGGGTCGCCGAGCCGCGG - Intronic
1043873811 8:85463743-85463765 GGCCGAGGGGAGCCGGGCGGCGG + Intergenic
1049405275 8:142449592-142449614 GGGCGAGCCAAGCCGAGCCGGGG - Exonic
1049681908 8:143922740-143922762 GGCCGAGATGAGCCGAGCCCAGG - Exonic
1052970149 9:34372427-34372449 GGCAGCGCCGGGCCGGGCCGTGG - Exonic
1053161267 9:35814925-35814947 GCGCGCGGCGCGCAGAGCCGTGG - Exonic
1053690457 9:40584306-40584328 GGCGGCGGCGAGGCGGGCGGCGG - Intergenic
1053690463 9:40584324-40584346 GGCGGCGGCGAGGCGGGCGGCGG - Intergenic
1054274341 9:63053143-63053165 GGCGGCGGCGAGGCGGGCGGCGG + Intergenic
1054301705 9:63385249-63385271 GGCGGCGGCGAGGCGGGCGGCGG - Intergenic
1054400482 9:64711785-64711807 GGCGGCGGCGAGGCGGGCGGCGG - Intergenic
1054400488 9:64711803-64711825 GGCGGCGGCGAGGCGGGCGGCGG - Intergenic
1054434080 9:65196065-65196087 GGCGGCGGCGAGGCGGGCGGCGG - Intergenic
1054434086 9:65196083-65196105 GGCGGCGGCGAGGCGGGCGGCGG - Intergenic
1054496305 9:65825602-65825624 GGCGGCGGCGAGGCGGGCGGCGG + Intergenic
1054496311 9:65825620-65825642 GGCGGCGGCGAGGCGGGCGGCGG + Intergenic
1054496317 9:65825638-65825660 GGCGGCGGCGAGGCGGGCGGCGG + Intergenic
1056350084 9:85741396-85741418 CGCCGCGGGGAGTCCAGCCGAGG - Intronic
1057379402 9:94554615-94554637 AACCGCAGCGAGGCGAGCCGCGG + Intergenic
1057443561 9:95098591-95098613 GGCCAAGGCGAGCAGCGCCGTGG - Intergenic
1058885712 9:109320285-109320307 GGGCGCGGCGGGCAGCGCCGAGG + Exonic
1060855874 9:126914867-126914889 GGCCACGCCGAGCCGGGCCGGGG - Exonic
1061541047 9:131277948-131277970 GGCGGCGGCGAGCGGACGCGGGG - Intergenic
1203470298 Un_GL000220v1:113022-113044 GGCCGCGCCGCGCCGCGCCGGGG + Intergenic
1203472951 Un_GL000220v1:124793-124815 GGGCGGGGCGAGGCGAGGCGAGG + Intergenic
1203478119 Un_GL000220v1:156994-157016 GGCCGCGCCGCGCCGCGCCGGGG + Intergenic
1187067514 X:15854888-15854910 GGCTGCGGCGAGCTGAGGGGCGG + Exonic
1197709342 X:129654651-129654673 GGCCCCGGCGAGCCGGCGCGGGG + Exonic
1199622207 X:149711941-149711963 GGGCGGGGCGAGGCGAGGCGGGG - Intronic
1199622215 X:149711961-149711983 GGGCGGGGCGAGGCGAGGCGGGG - Intronic
1199976602 X:152898135-152898157 GGCCGGGCCGGGCCGGGCCGGGG - Intergenic
1200277856 X:154751154-154751176 GGCCGCGGCGGCCGGAGGCGGGG - Intronic