ID: 1033654364

View in Genome Browser
Species Human (GRCh38)
Location 7:143362808-143362830
Sequence GGCCGCGGCGAGCCGAGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 250}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033654364_1033654376 -5 Left 1033654364 7:143362808-143362830 CCCCGGCTCGGCTCGCCGCGGCC 0: 1
1: 0
2: 3
3: 40
4: 250
Right 1033654376 7:143362826-143362848 CGGCCGGGGAGGGGGCGGCCCGG 0: 1
1: 1
2: 15
3: 138
4: 1203
1033654364_1033654380 2 Left 1033654364 7:143362808-143362830 CCCCGGCTCGGCTCGCCGCGGCC 0: 1
1: 0
2: 3
3: 40
4: 250
Right 1033654380 7:143362833-143362855 GGAGGGGGCGGCCCGGGGATTGG 0: 1
1: 0
2: 4
3: 55
4: 565
1033654364_1033654378 -3 Left 1033654364 7:143362808-143362830 CCCCGGCTCGGCTCGCCGCGGCC 0: 1
1: 0
2: 3
3: 40
4: 250
Right 1033654378 7:143362828-143362850 GCCGGGGAGGGGGCGGCCCGGGG 0: 1
1: 0
2: 14
3: 141
4: 983
1033654364_1033654374 -10 Left 1033654364 7:143362808-143362830 CCCCGGCTCGGCTCGCCGCGGCC 0: 1
1: 0
2: 3
3: 40
4: 250
Right 1033654374 7:143362821-143362843 CGCCGCGGCCGGGGAGGGGGCGG 0: 1
1: 3
2: 11
3: 157
4: 1257
1033654364_1033654377 -4 Left 1033654364 7:143362808-143362830 CCCCGGCTCGGCTCGCCGCGGCC 0: 1
1: 0
2: 3
3: 40
4: 250
Right 1033654377 7:143362827-143362849 GGCCGGGGAGGGGGCGGCCCGGG 0: 1
1: 2
2: 13
3: 218
4: 1577

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033654364 Original CRISPR GGCCGCGGCGAGCCGAGCCG GGG (reversed) Intergenic