ID: 1033656650

View in Genome Browser
Species Human (GRCh38)
Location 7:143380075-143380097
Sequence GTGAACAAGACGAAGGCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033656641_1033656650 24 Left 1033656641 7:143380028-143380050 CCTTGCCAGTAGAGTGTAGCCGG No data
Right 1033656650 7:143380075-143380097 GTGAACAAGACGAAGGCCTCAGG No data
1033656648_1033656650 5 Left 1033656648 7:143380047-143380069 CCGGATTTGGAGGGACTGGACAC No data
Right 1033656650 7:143380075-143380097 GTGAACAAGACGAAGGCCTCAGG No data
1033656643_1033656650 19 Left 1033656643 7:143380033-143380055 CCAGTAGAGTGTAGCCGGATTTG No data
Right 1033656650 7:143380075-143380097 GTGAACAAGACGAAGGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033656650 Original CRISPR GTGAACAAGACGAAGGCCTC AGG Intergenic
No off target data available for this crispr