ID: 1033658047

View in Genome Browser
Species Human (GRCh38)
Location 7:143386552-143386574
Sequence AAGCAGAAACAGGAAGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1259
Summary {0: 1, 1: 3, 2: 10, 3: 106, 4: 1139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033658043_1033658047 -2 Left 1033658043 7:143386531-143386553 CCACTGCTTTCTGCAGCTTGGAA 0: 1
1: 0
2: 8
3: 41
4: 348
Right 1033658047 7:143386552-143386574 AAGCAGAAACAGGAAGAGGGTGG 0: 1
1: 3
2: 10
3: 106
4: 1139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033658047 Original CRISPR AAGCAGAAACAGGAAGAGGG TGG Intronic
900177708 1:1298165-1298187 AAGGTGAAGCAGGAAGTGGGTGG - Intronic
900236933 1:1597480-1597502 AAGCAAAAACAGGCGGGGGGGGG - Intergenic
900304322 1:1996359-1996381 AAGCATAAACAGGAAGTTAGTGG + Intronic
900748636 1:4379010-4379032 AAGAAGAAAGAAGAAGAAGGAGG + Intergenic
900752969 1:4410894-4410916 AAGAAGAACCAGGAAGATGCGGG - Intergenic
900825074 1:4919860-4919882 ACGCAGTAACAGGCAGAGGTTGG - Intergenic
900983273 1:6058733-6058755 AGGAAGGAACAGGAGGAGGGAGG + Intronic
901182632 1:7352141-7352163 AAGCAGGGAGAAGAAGAGGGAGG + Intronic
901185287 1:7368952-7368974 AAGCAGAAGGAGGAAGGTGGAGG - Intronic
901244120 1:7715194-7715216 AAGGAAAATCAGGAAAAGGGGGG + Intronic
901519065 1:9768922-9768944 AAGGAGAAAGGGAAAGAGGGAGG + Intronic
901877019 1:12172663-12172685 AAGCACAGACAGGAAAAGGCAGG - Intronic
902750580 1:18506802-18506824 AAGTGGAATGAGGAAGAGGGAGG - Intergenic
903332850 1:22605197-22605219 AAAAAGAAAGAGGAAGAGGAAGG + Intergenic
903352487 1:22726185-22726207 AAGGAGAAAAAGGAGGAAGGAGG - Intronic
903603527 1:24558632-24558654 CAGGAGCAACAGGATGAGGGGGG - Intronic
903676539 1:25068050-25068072 AGGAAGAACCAGGAGGAGGGTGG - Intergenic
903820362 1:26097559-26097581 AAGCTCAAACAGGGATAGGGAGG - Intergenic
903923248 1:26816210-26816232 AGGAAGAAAGAGAAAGAGGGAGG + Intergenic
904087180 1:27917087-27917109 AAGCAGGAGGAGGAGGAGGGAGG - Intergenic
904104715 1:28069575-28069597 AAGAAGAAAAAAAAAGAGGGTGG + Intronic
904392984 1:30197952-30197974 AACCAGAGACAGAAAGAAGGAGG + Intergenic
904437206 1:30506648-30506670 AAGTAGGAACAGCAAGTGGGAGG + Intergenic
904440255 1:30525332-30525354 AAGAAGAAAGAGGAGGAGGAGGG + Intergenic
904487823 1:30839364-30839386 AAGAAGGCAGAGGAAGAGGGGGG - Intergenic
904693262 1:32310875-32310897 AGAAAGAAACAGGGAGAGGGAGG + Intronic
904805489 1:33128582-33128604 CTGTAGACACAGGAAGAGGGTGG - Intergenic
905294978 1:36948566-36948588 AATCAGAAAAAGGGAGAGGAAGG + Intronic
905770434 1:40634568-40634590 AAACAGGGAGAGGAAGAGGGTGG - Intronic
905873833 1:41419616-41419638 AGGCAAGAAAAGGAAGAGGGAGG - Intergenic
906124443 1:43418838-43418860 GAGCAGCAGCAGGAGGAGGGTGG + Intronic
906895767 1:49769516-49769538 AAGCAGAAAAAGAAAGAGCCAGG + Intronic
907044974 1:51295047-51295069 TGGCAGAAATAGGAGGAGGGTGG - Intronic
907404129 1:54243339-54243361 AACCGGAGACAGGAGGAGGGAGG + Intronic
907871040 1:58443115-58443137 AAGGAGGAACAGGAAGTGGCAGG - Intronic
908199600 1:61780601-61780623 AGGCAGAGGCAGGAGGAGGGAGG - Intronic
908445360 1:64194752-64194774 AAGATCAAACAGGAAGAAGGAGG - Intergenic
908532595 1:65047854-65047876 AGGCAGAAAAAGGGACAGGGAGG + Intergenic
908776958 1:67649701-67649723 AAGGAGAATCAGGAGGAGGTAGG + Intergenic
908960786 1:69694742-69694764 AAGGAGGAAGAGGAAGTGGGGGG - Intronic
909665402 1:78126783-78126805 AAGCACAATGAGAAAGAGGGAGG + Intronic
911013341 1:93305171-93305193 AAACAGAAACAGAGAAAGGGAGG - Intergenic
911014732 1:93320280-93320302 AAGCAGAATGAGCAAGAGGTGGG - Intergenic
911161167 1:94684344-94684366 AAGCAGAAAGAACAAGCGGGTGG - Intergenic
911228761 1:95337277-95337299 AAGAAAAAACAGGAAAAGAGGGG - Intergenic
911335599 1:96576461-96576483 ATGTAGAAACAGGTATAGGGAGG + Intergenic
911509237 1:98791149-98791171 CAGCAGAAAGAGGAGGAGAGGGG + Intergenic
911702554 1:100971050-100971072 AAGCTGAAGCAGGAAGTTGGGGG - Intronic
911877169 1:103181663-103181685 AAGAAGATACAGGTAGGGGGAGG - Intergenic
912065523 1:105736389-105736411 AAGAAGAAAAAGGAGGAGGAGGG + Intergenic
912202042 1:107469234-107469256 AAGCATGAACAGGAAGAGAATGG - Intronic
912374542 1:109199623-109199645 AAACATAAACGGGCAGAGGGTGG + Intronic
912460220 1:109825475-109825497 ATGCAGAAACAGGCAGAGAGAGG + Intergenic
912952467 1:114129462-114129484 AAGCAGAAACAGGGCTGGGGAGG - Intronic
913141378 1:115944644-115944666 AAGGAAAAACAGGAAGAGGAGGG + Intergenic
913414752 1:118592707-118592729 AAGCAGACACATGAAAAGAGGGG + Intergenic
913505526 1:119513198-119513220 ATGCACAATCAGGAAGAGTGTGG + Intronic
913962226 1:143349227-143349249 CAGCAGAAACTGGAAGAGGCTGG + Intergenic
913997235 1:143661504-143661526 AAGCAGAAATACGGAGAGGCCGG - Intergenic
914056582 1:144174801-144174823 CAGCAGAAACTGGAAGAGGCTGG + Intergenic
914122564 1:144791561-144791583 CAGCAGAAACTGGAAGAGGCTGG - Intergenic
914336968 1:146724406-146724428 AAGGGGAAACAGGAAGAATGGGG + Intergenic
914791477 1:150881182-150881204 AAGCAAAAACAGGCTGAGTGTGG - Intergenic
914956322 1:152165886-152165908 AAACAGAAACAGGAAGTGGAGGG - Intergenic
915119494 1:153619994-153620016 AAGAAGAAGCAGGAAGGGTGCGG + Intronic
915171582 1:153981923-153981945 AAGGAAAAAAAGGAAGAGAGAGG - Exonic
915492713 1:156260193-156260215 AGGCAGAGAAAGGAAGGGGGTGG + Intronic
915611418 1:156996425-156996447 AAGCAGCAGAAGGCAGAGGGAGG + Intronic
915750083 1:158199067-158199089 AAGCAGAAACAGGCCGGGCGCGG + Intergenic
915766564 1:158368315-158368337 AAGTAGAAACTGGAAGAGTTTGG - Intergenic
916388469 1:164304320-164304342 AAGCAGAAAGAGAGAGAGAGAGG + Intergenic
916398762 1:164422430-164422452 AAAGAGAAACAGCAAGAGAGAGG - Intergenic
916517530 1:165533414-165533436 GAGCTGAAGCAAGAAGAGGGAGG + Intergenic
916651104 1:166835567-166835589 AAGCAGAAGAAGGAGGAGGAAGG - Intergenic
916875463 1:168963991-168964013 GAGGAGAAACAGGAAAAGGAAGG - Intergenic
917083541 1:171281953-171281975 AAACAAAAACATGAACAGGGAGG - Intronic
917663835 1:177204481-177204503 AAGCAGAAAAAAAAAGAGAGTGG + Intronic
918069512 1:181124595-181124617 AAGCAGAAGGAGGAGGAGGAGGG - Intergenic
918179499 1:182074127-182074149 AAGAAGAAGGAGGAGGAGGGTGG + Intergenic
918372069 1:183870513-183870535 TAGCAGAAGCAGGAAGACAGCGG - Intronic
919038986 1:192357411-192357433 AGGGAGACACAGAAAGAGGGAGG + Intronic
919392962 1:197010533-197010555 AAGAAGAAAAAGAAAGAGAGAGG + Intergenic
919519936 1:198575596-198575618 AAACAAGAAAAGGAAGAGGGAGG - Intergenic
920111643 1:203591365-203591387 AAGCAGAGAGAGGAATTGGGGGG + Intergenic
921340792 1:214132324-214132346 AAGCAGAAATAAGGGGAGGGAGG - Intergenic
921571019 1:216778204-216778226 AAGTAGAAAACGGCAGAGGGAGG + Intronic
921760344 1:218906599-218906621 AAGCAGAGACAGGAAAATGAAGG - Intergenic
921930468 1:220750077-220750099 AAGCAGAATCACCAAGAGTGGGG + Intronic
922053657 1:222019643-222019665 GACCAGAAACAGGAAAAGGCAGG + Intergenic
922525676 1:226301470-226301492 CAGAAGAAAGAGGAAGAGTGGGG + Intronic
922572543 1:226642599-226642621 CAGCAGAAGAAGGAAGACGGAGG + Intronic
922722739 1:227906836-227906858 AAGGAGGATGAGGAAGAGGGAGG - Intergenic
922904999 1:229167614-229167636 ACGAAGAGAGAGGAAGAGGGAGG + Intergenic
922936293 1:229425710-229425732 GAGAAGAAAGAGGAGGAGGGGGG + Intergenic
922944705 1:229502965-229502987 AAGCAGAAACAACAAAAGAGAGG + Intronic
923355582 1:233151934-233151956 CAGCAGAGAGAGGCAGAGGGAGG - Intronic
923554082 1:234987055-234987077 AAACAAAAACAGGAAGTGGCCGG - Intergenic
923555531 1:234997808-234997830 CAGGAGGAAGAGGAAGAGGGGGG - Intergenic
923626168 1:235615735-235615757 AAGAAGCACCAGGAGGAGGGGGG + Intronic
923647654 1:235840384-235840406 AATGAGAAACAGGAAAAGTGAGG + Intronic
923837068 1:237623728-237623750 AACAAGAAAGAGGAAGAAGGAGG - Intronic
1062922822 10:1292953-1292975 AAGGAGAGAGAGGGAGAGGGAGG + Intronic
1062936556 10:1394896-1394918 AAGAAGAAGGAGGAGGAGGGAGG - Intronic
1063790973 10:9447488-9447510 AAGGAAAAAAAGGAAGAGAGAGG - Intergenic
1063956573 10:11273047-11273069 ACACAGAAAGAGGAAGAGAGCGG - Intronic
1064037577 10:11927035-11927057 AAACAGACAAATGAAGAGGGTGG + Intronic
1065114896 10:22476011-22476033 AAGCATGAGCAGGAAGAGGCTGG + Intergenic
1065123872 10:22554530-22554552 GTGCAGAAACAGCCAGAGGGTGG + Intronic
1065416890 10:25498044-25498066 GAGCAGAAAGAGAAAGAGGAAGG + Intronic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067254351 10:44621177-44621199 AAGAAGAAACAGGAAGAACAAGG + Intergenic
1067382440 10:45787406-45787428 AAGCAGGTGCAGGATGAGGGGGG - Intronic
1067509511 10:46883435-46883457 AGGCAGAATCAGGGAGAGGAAGG - Intergenic
1067652743 10:48168420-48168442 AGGCAGAATCAGGGAGAGGAAGG + Intronic
1067665196 10:48271597-48271619 AAGCAAATACAGGAATAAGGAGG + Intronic
1067794339 10:49309907-49309929 AAGGGGAAACAGGAAGACAGTGG - Intronic
1067890138 10:50127954-50127976 AAGCAGGTGCAGGATGAGGGGGG - Intronic
1067902330 10:50255238-50255260 AAGAAGAAGTAGGAAGGGGGAGG + Intergenic
1068106167 10:52619579-52619601 AAGCAGCAATAGGCAGAGGAAGG + Intergenic
1068714506 10:60173662-60173684 AAACACTAAAAGGAAGAGGGAGG + Intronic
1068976948 10:63020517-63020539 AAGCATCCACAGGAAGAGAGAGG - Intergenic
1069169987 10:65214743-65214765 AAGCAGAAAAAAGATGAGAGTGG + Intergenic
1069582592 10:69575846-69575868 AAGGAGAAAGAAGAAGAAGGAGG - Intergenic
1069950708 10:72016340-72016362 AAGAAGAAAAAGAAAGAGGAAGG + Intergenic
1070016532 10:72538669-72538691 AAGGAAAAAAAGGAAGAGAGGGG + Intronic
1070403761 10:76076392-76076414 AAGAAGAAAGAGAAAGAGAGAGG - Intronic
1070485454 10:76926285-76926307 AATTAGAAACAGAAAGAGGCAGG - Intronic
1070574986 10:77670935-77670957 AGGGAGAAACAGAAAGAGAGAGG + Intergenic
1070813423 10:79309663-79309685 TAGGAGAAACAGGAAGAGGAAGG + Intronic
1070835868 10:79446483-79446505 GAGCAGAAATAGGAGAAGGGGGG - Intergenic
1071026443 10:81119988-81120010 AAGCAGAAAGATCAAGGGGGAGG - Intergenic
1071270924 10:84006608-84006630 AAGGAGAAAGAGCAAGAGGGAGG - Intergenic
1071811582 10:89187549-89187571 AAGCAGATACTGGAGGAGGCAGG + Intergenic
1071990244 10:91094207-91094229 AAGCAGAAGTTGGAAGAGTGTGG - Intergenic
1072085638 10:92076794-92076816 AAGGAGAAAGAGGAGGAGGAGGG + Intronic
1072277141 10:93834410-93834432 AAGCAGAAACTGGAAGAGTGTGG - Intergenic
1072606881 10:96991803-96991825 AAGCAGAGGCAGGAGGAGGGAGG - Intergenic
1072715785 10:97751614-97751636 AACCAGAAACAGGAGTGGGGAGG - Intronic
1072717734 10:97762815-97762837 AGGCAGAAAGAGGGGGAGGGTGG - Intergenic
1072783053 10:98262978-98263000 CAGCAGGAACAGAAAGAGGGTGG + Exonic
1072792910 10:98331683-98331705 AACCAGAAATAGGAATAGGGAGG - Intergenic
1073048966 10:100655925-100655947 GAGCAGAAAAGGGAAGAGGAAGG - Intergenic
1073065943 10:100759247-100759269 AAGGAGAAAGGGGAAGAGGAAGG + Intronic
1073149292 10:101300894-101300916 TAGAAGAAAAAGGCAGAGGGAGG + Intergenic
1073294464 10:102430640-102430662 GACCAAAAACAGGAGGAGGGAGG - Intronic
1073576706 10:104631937-104631959 AAGCAAAAGGAAGAAGAGGGAGG - Intergenic
1073698653 10:105899373-105899395 AAGGAGAAACAGGGAGAGAGAGG + Intergenic
1073796274 10:106991787-106991809 GAGGAGAGACAAGAAGAGGGAGG + Intronic
1073810510 10:107147532-107147554 AATGAGACACAGGAAGAGAGAGG - Intronic
1074015160 10:109527227-109527249 AAGAAGAGAAAGGGAGAGGGAGG - Intergenic
1074422519 10:113322026-113322048 AAGCAGAACCTGGGGGAGGGGGG + Intergenic
1074449115 10:113544899-113544921 AAGCAGAAACAGACAGAGCCAGG - Intergenic
1074831467 10:117252601-117252623 AAGAAGAAAGAGAATGAGGGAGG + Intronic
1074832611 10:117260145-117260167 AGGCTGAAACAGGAACATGGTGG - Intronic
1074994979 10:118748948-118748970 AAGAAGAGTCAGGAGGAGGGAGG + Intronic
1075189081 10:120289516-120289538 AAGGAGAAAGGAGAAGAGGGTGG + Intergenic
1076066903 10:127456013-127456035 AAGGAGAAAGGGGGAGAGGGAGG - Intergenic
1076075104 10:127527501-127527523 AGGCAGACAGAGGAAGAGGAAGG - Intergenic
1076353680 10:129836769-129836791 AAGAAGAAAAAGGAAAAGGTGGG + Exonic
1076444219 10:130500803-130500825 AGGCAGACACAGGAACCGGGAGG + Intergenic
1076584518 10:131536397-131536419 AGAAAGAAACAGAAAGAGGGAGG + Intergenic
1076600554 10:131654522-131654544 AAGCAGGGCCAGGAAGAGGCAGG - Intergenic
1077025740 11:439115-439137 GTGCAGACACAGGAAGAAGGTGG + Intronic
1077032343 11:474230-474252 AGGCAGAAGCAGGAAGAGAAGGG - Intronic
1077881418 11:6353656-6353678 AGGCCGAAGGAGGAAGAGGGAGG + Intergenic
1078300312 11:10123240-10123262 AAACAGAAACAGGAATAAGAAGG + Intronic
1078423670 11:11232480-11232502 AAGCAGACCCAGGAAGGGGGTGG - Intergenic
1078528173 11:12116534-12116556 AAACAGAAACTAGAGGAGGGAGG - Intronic
1078613931 11:12847324-12847346 AAGCAAAAACAGGCAGAATGTGG + Intronic
1079201983 11:18384272-18384294 ATGCAGCACCAGGGAGAGGGAGG + Intergenic
1079445555 11:20553592-20553614 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1079552828 11:21721749-21721771 AAGCAGGAGGAGCAAGAGGGAGG - Intergenic
1080165000 11:29225388-29225410 AAGAAGAGACAGAAAGAGGTGGG - Intergenic
1080360277 11:31505730-31505752 GAGCAGAAGGAGGAAGAGGAGGG - Intronic
1080951207 11:37035308-37035330 AAGAAGAGAGAGAAAGAGGGAGG - Intergenic
1081057709 11:38431189-38431211 AAGCAGACAGAGGAACAGGAAGG + Intergenic
1081591706 11:44427657-44427679 GGGCAGAAAGAGGAAGAGTGAGG - Intergenic
1081761961 11:45582879-45582901 CAGCAGAAATAGGAGGAAGGTGG - Intergenic
1082179769 11:49103314-49103336 AAGCAGAACCAGTAGGAGGGCGG - Intergenic
1082820009 11:57538348-57538370 CAGAAGAAACAGGAAGAGAGAGG + Intergenic
1083336115 11:61922831-61922853 GAGCAAAAACAGGAAGCGGGTGG - Intergenic
1084639450 11:70415882-70415904 ATCCAGAAACATGAAGAGGAGGG - Intronic
1084771038 11:71343214-71343236 AAGCAGAAGCAGGCAGGGAGTGG + Intergenic
1084897269 11:72282502-72282524 AAAGAGAAAAATGAAGAGGGAGG + Intergenic
1084921776 11:72476640-72476662 AAGCATAGAAAGGAGGAGGGTGG + Intergenic
1084952560 11:72674743-72674765 AGGCAGAAATAGAAAGAGAGTGG + Intergenic
1084965361 11:72741646-72741668 AGGCAGAAACAGGAAGAGACAGG + Intronic
1085081007 11:73634161-73634183 AAGCAGACACAGGAAGACCAGGG + Intergenic
1085506437 11:77063485-77063507 TGGCAGAACCAGGAAGAGAGGGG + Intergenic
1085694539 11:78692722-78692744 AAGCAGATACAGGGAGAAGAAGG - Intronic
1085807658 11:79651052-79651074 AAGGAGAAGAAGGAAGATGGAGG - Intergenic
1085947443 11:81288509-81288531 TAGCTGTAACAGGGAGAGGGAGG + Intergenic
1085968501 11:81558044-81558066 AAGCAGAAACAGGTAGGAGGAGG - Intergenic
1086302508 11:85442912-85442934 AAGAAGAAAGAAGAAGAAGGAGG + Intronic
1086302510 11:85442922-85442944 AAGAAGAAGGAGGAAGAAGGAGG + Intronic
1087137913 11:94739348-94739370 AAGCAGGAAAAAGAAGAGGTTGG + Intronic
1087589182 11:100163640-100163662 CAGCAGAAACAAGAAGTGTGTGG - Intronic
1088058292 11:105611207-105611229 AAGGAGAGAAAGGAAGAGGAGGG - Intronic
1088784534 11:113169019-113169041 ACACAGAAAGAGGAAGAGAGAGG - Intronic
1089515118 11:119027274-119027296 AATGAGAAACAGGACCAGGGAGG + Intronic
1089538111 11:119173045-119173067 AAGGAGAAGCAGGGTGAGGGAGG + Intronic
1089596513 11:119584375-119584397 AGGCAGATAATGGAAGAGGGGGG + Intergenic
1089745370 11:120613219-120613241 AAGAAGAAACAGAAAGTGTGAGG - Intronic
1089992355 11:122873517-122873539 AAGCAATCACAGGAAGGGGGAGG - Intergenic
1090159906 11:124481830-124481852 ACCTAGAAACAGGAAGAAGGCGG + Intergenic
1090165590 11:124543559-124543581 ACCCAGAAACAGGAAGAAGAGGG + Exonic
1090583371 11:128184099-128184121 AAACAGCAACAAGAAGAGGGTGG - Intergenic
1090672998 11:128963486-128963508 AAAGAGAAAAAGGAAGAGGAGGG + Intergenic
1090742919 11:129682347-129682369 CACCAGAAGCAGGAAGAGGCAGG - Intergenic
1090968924 11:131622973-131622995 AAAGAGAAAGAGGAAGAGGAAGG + Intronic
1091033412 11:132211736-132211758 GAGTGGATACAGGAAGAGGGTGG + Intronic
1091069266 11:132548041-132548063 AAGCAGAAACAGCATTTGGGAGG + Intronic
1091241186 11:134053544-134053566 AAGAATAAACAGCAAGAGGCAGG + Intergenic
1091533474 12:1383229-1383251 CAGAAGAAACAGGGAGAGGAGGG - Intronic
1091750924 12:3020812-3020834 AAGCAGAAACAGAGGGAGAGGGG - Intronic
1092069589 12:5621846-5621868 AAAAAGAAGGAGGAAGAGGGAGG + Intronic
1092248141 12:6874942-6874964 AGGAAGAAACAGGCACAGGGAGG - Intronic
1092385817 12:8034751-8034773 AACAAGAAACAGGAAGGGAGAGG - Intronic
1092606588 12:10126950-10126972 AAGAAGAAATAGAATGAGGGAGG + Intronic
1092708726 12:11311484-11311506 AAGAAGAACCAGAAAGAAGGTGG - Intergenic
1093499791 12:19798727-19798749 AAAGAGAACAAGGAAGAGGGAGG - Intergenic
1093633536 12:21437885-21437907 AAGAAGAAAAAGGGAGGGGGTGG - Intronic
1093756167 12:22854278-22854300 AAGGAGAGAAAGAAAGAGGGAGG - Intergenic
1094184869 12:27630758-27630780 AAGCAGGAAGAGTGAGAGGGAGG - Intronic
1094232414 12:28122327-28122349 AAGCAGAAGAATGAGGAGGGGGG + Intergenic
1094447758 12:30550213-30550235 AAGCAGGAGGAGGAAGAGGAGGG - Intergenic
1095312477 12:40716361-40716383 AAGAAGAAAGAAGAAAAGGGAGG - Intronic
1095382057 12:41606778-41606800 AGGCAGAAAGAGAAGGAGGGAGG - Intergenic
1095650581 12:44604189-44604211 AAGAAGAAAGAGAAGGAGGGAGG + Intronic
1095966682 12:47872352-47872374 TAGCAGAAAGAGGCAGTGGGAGG + Intronic
1096012582 12:48233357-48233379 AGGCAGAGACATGAAGAGAGGGG - Intergenic
1096089930 12:48892290-48892312 AAGGAGAAAGAGAAAGAGAGAGG - Intergenic
1096178172 12:49536780-49536802 AAGAAGAAAGAAGAAGAAGGAGG - Intergenic
1096497306 12:52045944-52045966 AAGCAGGAAGAGGAAGTGGCCGG + Intronic
1096749958 12:53752192-53752214 AGGCAGAAAGAGACAGAGGGTGG - Intergenic
1096831522 12:54318167-54318189 AAGAAGTAACAGAAAGAGGCTGG - Intronic
1097174092 12:57132951-57132973 AAGAAGAAAGAGGAAGTCGGAGG - Intronic
1097242427 12:57584839-57584861 AGGGGAAAACAGGAAGAGGGAGG - Exonic
1097369795 12:58763918-58763940 AAGCAGAGACAGGAATAAAGGGG - Intronic
1097469089 12:59966443-59966465 AAGAAGAAAGAGGAAGAGAAAGG - Intergenic
1097485263 12:60189506-60189528 CACCAGAAACTGGAAGAGGCAGG + Intergenic
1097548058 12:61029519-61029541 AAGAAGAAAGAAGAAGAAGGAGG - Intergenic
1097961183 12:65533395-65533417 CAGCAGAGACAGGAGGAGGGAGG - Intergenic
1098165680 12:67695191-67695213 AAGCAAAACCAGTAAGATGGGGG - Intergenic
1098617064 12:72539521-72539543 AGCCAGACATAGGAAGAGGGTGG + Intronic
1098619518 12:72577166-72577188 AAGCAGAAAAAGAGAGAGTGAGG + Intronic
1099064943 12:77964020-77964042 AAGGAGAAAAAGGAGGAGGAGGG - Intronic
1099163839 12:79276937-79276959 AAGAAGAAGAAGGAAGAAGGAGG + Intronic
1099227119 12:79982978-79983000 AAGAAGAAACAGAGAGAGAGAGG - Intergenic
1099573085 12:84349553-84349575 AAGCAGAGAAAGGAAGAGACAGG - Intergenic
1099974079 12:89528213-89528235 AAGCAGAAAAGGGAAGAAGTTGG + Intergenic
1101345034 12:103878941-103878963 AAGCAGCAAGGGGAAGAAGGAGG - Intergenic
1101925728 12:108969802-108969824 CTCCAGAAACAGGAAGTGGGTGG + Intronic
1102167815 12:110820611-110820633 AAGAAGAAAGAAGAAGAGGAGGG - Intergenic
1102260568 12:111440750-111440772 AAGATGGAAAAGGAAGAGGGAGG + Intronic
1102771267 12:115479017-115479039 AAGAAAAAATAGGAAAAGGGGGG + Intergenic
1103262203 12:119597112-119597134 AAGGACAAAGAGGAAGAGGAAGG + Intronic
1103449478 12:121018381-121018403 TAGCAGAAGCGGGAAGAGAGCGG - Intergenic
1103949228 12:124542210-124542232 CAGCAGCCACAGGAACAGGGCGG + Intronic
1104080738 12:125428577-125428599 ACGGAGAAAAAGGAAGATGGAGG - Intronic
1104200995 12:126588709-126588731 AAGCAGAAAAGGGAGGTGGGCGG + Intergenic
1104364301 12:128163195-128163217 CAGTAGTCACAGGAAGAGGGGGG - Intergenic
1105883824 13:24625647-24625669 AAACAGAAACAGGAAGCAGAAGG - Intergenic
1105993970 13:25652474-25652496 AATAAGAATAAGGAAGAGGGAGG - Intronic
1106852330 13:33807737-33807759 AAACAGAAATAAGAAGAGGATGG - Intergenic
1107322439 13:39203906-39203928 AAGAAGAAACAGAAATTGGGAGG + Intergenic
1107588508 13:41879302-41879324 CAGCAGAAAGAGGAGGAGGGTGG - Intronic
1107605940 13:42056867-42056889 AGGCAGGAGCAGGAAGAAGGGGG - Intronic
1107724579 13:43285841-43285863 AAGAAGAAAGAAGAAGAGGGGGG - Intronic
1107777604 13:43862965-43862987 AAGGATGAAGAGGAAGAGGGAGG - Intronic
1107999430 13:45892727-45892749 AAGAAGCAACAGGAGGAAGGAGG + Intergenic
1108292348 13:48974776-48974798 AAGCAGAAAGAATAAGAGGAAGG + Intergenic
1108583030 13:51843635-51843657 AATCTGAAACAGGAAGAGATTGG + Intergenic
1109106200 13:58253541-58253563 AAGAAGAAAAATGAGGAGGGAGG - Intergenic
1109617193 13:64851002-64851024 AAGGAAAAAGAGGGAGAGGGAGG - Intergenic
1109672436 13:65626677-65626699 AAGGAGAAACAAGTAGAGAGTGG - Intergenic
1109985120 13:69970777-69970799 AAACAGAAGCAGGCAGAGGAAGG - Intronic
1110476987 13:75927873-75927895 AATTAGAAACAGGAAAAGAGAGG + Intergenic
1110778177 13:79433701-79433723 AAGCAAAAAGAGGAAGAAGAGGG + Intergenic
1110955610 13:81549251-81549273 CAGGAGAAACAGTGAGAGGGGGG + Intergenic
1111106170 13:83648462-83648484 AAGAAGAAAGAAGAAGAAGGAGG + Intergenic
1111181005 13:84665049-84665071 AAAGAGAAATAGGAAGAGGAAGG + Intergenic
1111201819 13:84948269-84948291 AACCAGAAACAGGAGGTGAGTGG + Intergenic
1111463503 13:88576821-88576843 AAGCAGAAATTGGAAGAGTTTGG - Intergenic
1111664057 13:91245177-91245199 AAGCAGACACAGGGAGAGGGAGG - Intergenic
1111797935 13:92946863-92946885 AAGGAGGAAAAGGAAGAGGGAGG + Intergenic
1112225761 13:97538313-97538335 CAGGACAAACAGGAAGAGTGTGG + Intergenic
1112258283 13:97854648-97854670 AAGTAGAAACGGGAAGATGTTGG + Intergenic
1112378171 13:98863091-98863113 AAACAGAGGCAGGTAGAGGGTGG + Exonic
1112477690 13:99747311-99747333 AACCAGAAAAAGGAGAAGGGGGG - Intronic
1112750269 13:102576237-102576259 AGGAAGAAAGAAGAAGAGGGGGG - Intergenic
1112786251 13:102954912-102954934 AAGAAGAAAGAGGAAGAGGAGGG - Intergenic
1113127726 13:106999038-106999060 CTGAAGAAAGAGGAAGAGGGAGG - Intergenic
1113222471 13:108120691-108120713 AAACAGAGACAGAAGGAGGGGGG - Intergenic
1113405600 13:110036656-110036678 GAGCACGAACAGGGAGAGGGAGG + Intergenic
1113680678 13:112242191-112242213 AAGAAGAAAAAGGGAGAGGGAGG + Intergenic
1113778406 13:112961924-112961946 AGGCAGAAACTGGAGGAGGTGGG - Intronic
1114201220 14:20522572-20522594 AAGGAGAAGGAGGAGGAGGGAGG + Intergenic
1114643155 14:24238120-24238142 AAGCAGAAGGAGGAAGACGCTGG + Intronic
1114881905 14:26796717-26796739 AAGAAGAAAGAGAAAGAAGGAGG + Intergenic
1115024764 14:28730348-28730370 TAGCAGAAACAGGATGACGAAGG - Intergenic
1115329029 14:32173856-32173878 AAGAAGAAAGACAAAGAGGGAGG - Intergenic
1115399020 14:32938328-32938350 AAACAGAAAAAGGAACTGGGAGG - Intronic
1115517124 14:34196952-34196974 AAGCAGAAACAGCAATTTGGAGG - Intronic
1115642361 14:35342684-35342706 GAGGAGAAACAGGATGATGGTGG - Intergenic
1115713584 14:36076998-36077020 AACCAGAAATAGGAAGAGGATGG + Intergenic
1115815571 14:37160963-37160985 GAGGAGAAAGAGGAAGGGGGTGG + Intronic
1116264848 14:42674839-42674861 ACCAAGTAACAGGAAGAGGGTGG - Intergenic
1116628408 14:47297393-47297415 AAGAAGAAAGAGGAAGGGAGGGG + Intronic
1117014616 14:51505904-51505926 AAGTAGAAACAGGGAGATGAAGG - Intronic
1117473035 14:56065861-56065883 AAGCAGTAACAAGGTGAGGGCGG + Intergenic
1117937904 14:60927699-60927721 GAGCAGAAACAGAAAGAAGGTGG - Intronic
1118036358 14:61872587-61872609 GAGAAGAAACAGGAAGGGGCAGG - Intergenic
1118720337 14:68589518-68589540 CAGCAGAGAAAGGGAGAGGGAGG - Intronic
1118767721 14:68921322-68921344 AAGCAGAAGAAAGAAGAGGCAGG - Intronic
1119010193 14:70977602-70977624 AAGCAGGAACAAAAAGTGGGAGG + Exonic
1119947792 14:78713245-78713267 AAGCAGACCCAGGAAGGGGTTGG - Intronic
1120147411 14:80994042-80994064 AAGGAGGAAAAGGAAGAGGAGGG - Intronic
1120185876 14:81393417-81393439 CAGCAGCAGCAGGAAGAGTGAGG + Intronic
1120515194 14:85462202-85462224 AAGAAGGAAGAGGACGAGGGAGG - Intergenic
1120640395 14:87004004-87004026 AATGAAAAATAGGAAGAGGGTGG + Intergenic
1120643173 14:87040038-87040060 AAGCATAGACAGGCAGATGGGGG - Intergenic
1120778629 14:88464990-88465012 AGCCAGAAACAGGAGGAGGAGGG - Intronic
1121280744 14:92695851-92695873 AAAGAGAAACAGGGAGAGAGAGG - Intergenic
1121645542 14:95515485-95515507 AAGCAGAAACAGGCCCAGAGAGG - Intergenic
1121832763 14:97066124-97066146 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1122109461 14:99486806-99486828 ATGCAGAAAGAGGAAGAGTTAGG - Intronic
1122322240 14:100862054-100862076 AAGGAGAAAGAAGAAGAGGAAGG - Intergenic
1122357384 14:101131889-101131911 AAGCAGAAGTAGGAGGAGGGAGG - Intergenic
1122499144 14:102184523-102184545 AAGCAGGAACAAGCAGAGGGCGG - Intronic
1122811208 14:104290242-104290264 AAGCAGCAGCAGGAAGCAGGAGG - Intergenic
1202844535 14_GL000009v2_random:156042-156064 AAGAAGAAGCAGGAAGCTGGGGG - Intergenic
1202913926 14_GL000194v1_random:146283-146305 AAGAAGAAGCAGGAAGCTGGGGG - Intergenic
1202878728 14_KI270722v1_random:36419-36441 AAGAAGAAGCAGGAAGCTGGGGG + Intergenic
1124352595 15:28968813-28968835 AAGCAGACACGTGCAGAGGGAGG + Intronic
1124463111 15:29911347-29911369 CAGCAGAAGAAGGAAGAGGCAGG + Intronic
1124879508 15:33628295-33628317 AAGCCAAGAAAGGAAGAGGGAGG + Intronic
1125397649 15:39267843-39267865 AAACAGAAACAGGAAATGAGTGG + Intergenic
1125446169 15:39759731-39759753 CATCAGAAGCTGGAAGAGGGAGG - Intronic
1125480633 15:40077275-40077297 AAAAAGAAAGAGAAAGAGGGAGG + Intergenic
1125753833 15:42049082-42049104 AGGCAGAGTCAGGAAGAGGAAGG + Intronic
1125787830 15:42337763-42337785 AAGAAGATACATGAAGAGGCTGG + Intronic
1126052322 15:44697230-44697252 AAGAAGAAACAAGAAAAGGGAGG - Intronic
1126096757 15:45095655-45095677 ACGGAGACACAGGCAGAGGGAGG + Intronic
1126326522 15:47483854-47483876 AAACAGAAACAATAAGAGAGGGG - Intronic
1126477764 15:49083990-49084012 AAGGAAAAACAGGAAAAGTGGGG + Intergenic
1126560959 15:50043501-50043523 AAGGAGGAAGAGGAAGAGGAGGG - Intronic
1126783114 15:52155233-52155255 AAACAGACAGAGGAACAGGGTGG + Intronic
1127043736 15:55004272-55004294 AAGCACACACAGAAAGCGGGGGG + Intergenic
1127075740 15:55323833-55323855 AAAAAGAAAGAGGAAGAGGAGGG + Intronic
1127210103 15:56765385-56765407 AAGAACAAACAGGATGTGGGAGG + Intronic
1127781469 15:62320285-62320307 ATGCAAAAACAGGAAGGAGGGGG - Intergenic
1128029611 15:64468302-64468324 AAGCAGAAGGAGGAGGAGAGAGG - Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1129238609 15:74238833-74238855 CAGCAGAGACAGCAAGAGTGTGG + Intronic
1129527976 15:76234592-76234614 CAACAGAAACAGAAAGAAGGAGG + Intronic
1129595706 15:76962497-76962519 ATGGAGAAACCGGTAGAGGGTGG - Intergenic
1129679128 15:77648048-77648070 CAGCAGCCACAGGGAGAGGGTGG + Intronic
1129905277 15:79182881-79182903 AAGGAAAGAAAGGAAGAGGGAGG - Intergenic
1130203047 15:81851097-81851119 AAGCTGGAAGAGGAAAAGGGTGG + Intergenic
1130411433 15:83652101-83652123 AAGCTGAAACAAGAAGACAGAGG - Intergenic
1130571075 15:85044341-85044363 AATCAGGAACAGGTAGGGGGAGG + Intronic
1130577038 15:85102189-85102211 AAACAGAAGCAGGAAAAGAGGGG + Intronic
1131340005 15:91590204-91590226 AAGAAGAAAGAGGAAAAGGAAGG + Intergenic
1131390450 15:92043881-92043903 AGGGAGAAACAGGAGGAGGGAGG - Intronic
1131446318 15:92500586-92500608 AAACAACATCAGGAAGAGGGGGG + Exonic
1131656950 15:94470898-94470920 ATCCAGAAGCAGGGAGAGGGAGG + Intronic
1131667384 15:94585070-94585092 AAGAAGGAAGAGGGAGAGGGAGG - Intergenic
1131899853 15:97075794-97075816 CAGCAAAAACAGGAATAAGGAGG + Intergenic
1132225218 15:100135096-100135118 CAGGAGAAAGAGGAAGAAGGTGG + Intronic
1132325129 15:100962627-100962649 AAACAGAGACAGGGAGAGGGAGG + Intronic
1132347475 15:101116979-101117001 AAGCAGACACCCGAAGAGGGAGG + Intergenic
1132351865 15:101144624-101144646 TAGCAGAAACAGGAAGATATGGG + Intergenic
1132396992 15:101481472-101481494 AAGCAAAAGCATGAAGATGGGGG + Intronic
1132996963 16:2828521-2828543 AGGCAGAAACAGGAGGTGGTTGG + Intergenic
1133064386 16:3195730-3195752 AAACAGAAAAAGAAAGAGGGTGG - Intergenic
1133482695 16:6186585-6186607 AAGCAGAGATAGGGAGAGTGTGG + Intronic
1133668995 16:7999148-7999170 ATGCAAGAACAGGAGGAGGGGGG - Intergenic
1133713827 16:8427969-8427991 AAAAAAAAAAAGGAAGAGGGTGG + Intergenic
1133756057 16:8763376-8763398 AAGCAGAAAAAGCAAGAGGTAGG + Intronic
1133884619 16:9814609-9814631 AAACAGGACAAGGAAGAGGGAGG - Intronic
1133887359 16:9843000-9843022 AAACAGAAAGAGAAAAAGGGGGG + Intronic
1133936780 16:10275797-10275819 AATGAGAGACAGGAAGTGGGAGG - Intergenic
1135127694 16:19824748-19824770 AAGATGAACCAGGAAGAGGAAGG + Intronic
1135147990 16:19979736-19979758 AGGGAGAAAAGGGAAGAGGGAGG + Intergenic
1135156155 16:20054707-20054729 AAGGAAAGAAAGGAAGAGGGAGG - Intronic
1135177397 16:20242792-20242814 AACGAGGAACAGGAAGAGGTAGG + Intergenic
1135295730 16:21278009-21278031 AAGGAGGAGCAGGAAGAGGAGGG - Intronic
1135627871 16:24011815-24011837 ATGAAGAAACAGGAACAGAGAGG - Intronic
1135783456 16:25326679-25326701 TAGCTAAAACAGGGAGAGGGTGG - Intergenic
1135963420 16:27016402-27016424 AAGAAGAAGGAGGAAGTGGGGGG - Intergenic
1136367413 16:29815136-29815158 AGGCAGGAAGAGGAAGGGGGCGG - Intronic
1136416437 16:30107065-30107087 AGCCAGAGACAGGGAGAGGGAGG - Intronic
1136539111 16:30918763-30918785 AAGAAGGAAGAAGAAGAGGGAGG - Intergenic
1136656623 16:31713141-31713163 AAGCAGAACGAGTGAGAGGGCGG + Intergenic
1137373053 16:47926627-47926649 TAGCAGAAACATGAGAAGGGAGG + Intergenic
1137466629 16:48715684-48715706 AAGCAGAACCAAGCAGAGGGAGG - Intergenic
1137862814 16:51863825-51863847 AAGCAGAAAAAGGAAGAGACCGG - Intergenic
1137968358 16:52959108-52959130 AAGAAGAAAAAGGAGGAGGAGGG - Intergenic
1137968378 16:52959217-52959239 AAGAAGAAATAGAAAGAAGGAGG - Intergenic
1138075727 16:54040728-54040750 GTGGAGAAACAGGAAGAGAGTGG + Intronic
1138293860 16:55870323-55870345 AAGAAGAAAGAGGAAGAGGAAGG + Intronic
1138979976 16:62256221-62256243 GAGAAGAAACGGGAAGGGGGTGG + Intergenic
1139202204 16:64989393-64989415 AAGCAGAAAGAGGGAGAGATTGG + Intronic
1139432253 16:66917546-66917568 AAAGAGAAACAGCAAGAGGAAGG + Intronic
1139997303 16:70992913-70992935 AAGGGGAAACAGGAAGAATGGGG - Intronic
1140506998 16:75479751-75479773 AACCAGAAAGAGGAGGAGGAAGG + Exonic
1140903586 16:79392188-79392210 AAGGAGAGACAAGAAGAGAGAGG + Intergenic
1141046998 16:80724209-80724231 GAGAAGAAAGAGGAAGAGGAGGG + Intronic
1141278044 16:82605885-82605907 AAGCAGCAGTAGGAAGATGGAGG - Intergenic
1141514594 16:84535193-84535215 AAGGAGAAGGAGGAAGAGGAGGG - Intronic
1141541315 16:84724625-84724647 AAGCAGACAAAGGAAGAAGGAGG - Intronic
1141766665 16:86063690-86063712 AAGGAGAGGGAGGAAGAGGGAGG + Intergenic
1141775723 16:86121615-86121637 AAGAAGAAGGAGGAGGAGGGAGG - Intergenic
1142030059 16:87834098-87834120 AGGCAGAAAGAGGCAGAGGCAGG - Intronic
1142510509 17:389759-389781 AAGTAGAAACTGGAAGAAAGCGG + Intergenic
1142683986 17:1566723-1566745 CAGGAGAAACAGGAAGAGAGAGG - Intergenic
1142707226 17:1703298-1703320 AAGCCCATACAGGAAGAGTGAGG - Exonic
1143391364 17:6561092-6561114 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143711291 17:8736970-8736992 AAGAAGAAAGAGAGAGAGGGAGG + Intronic
1143814742 17:9503522-9503544 ATGAATAAAAAGGAAGAGGGAGG - Intronic
1143869468 17:9947897-9947919 AAGCAGGAGGAGGAAGAGGAGGG - Intronic
1144678370 17:17176231-17176253 ATACAGAAACAGGAAGAGGAAGG - Intronic
1144746790 17:17621396-17621418 AAGAAGAAAGAGGAAGAAGAAGG + Intergenic
1145266432 17:21381693-21381715 AAGCAGGAAAAGGAACATGGGGG - Intronic
1146757586 17:35447419-35447441 ATGCAGAAACATGTAGAGAGAGG + Intronic
1146780445 17:35666522-35666544 AATCAGATACAGAAAGAAGGGGG - Intronic
1146937743 17:36823235-36823257 GAGTAGAGACAGGCAGAGGGAGG - Intergenic
1147020342 17:37526705-37526727 AAGCAGAGAGAAGAAGAGAGTGG - Intronic
1147155942 17:38544544-38544566 AATCAGAGACAGGAAGGGGAGGG + Intronic
1147498792 17:40942407-40942429 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1147846941 17:43411121-43411143 AAACAGAAAGAGAAAGAAGGTGG - Intergenic
1148446235 17:47739287-47739309 ATGGAGACACAGGAAGAGGCTGG - Intronic
1148505116 17:48121221-48121243 AAGCAGCAACTGGAAAAGAGTGG - Exonic
1148554363 17:48569437-48569459 AAGCAGAAGCAGGAGGAGAAGGG - Intronic
1148804295 17:50256555-50256577 AAGAAGAAAAAGGAGGAGGAGGG + Intergenic
1148807081 17:50269357-50269379 AAGCAGAAAGAGTAAGAGGAGGG + Intergenic
1149354756 17:55828365-55828387 AGGCAGAAACTGGAAGAGGCAGG - Intronic
1149498467 17:57133974-57133996 AAACAGAAAAAGAGAGAGGGAGG - Intergenic
1149530990 17:57395138-57395160 AAACAGACACAGAAAGAAGGTGG - Intronic
1149544222 17:57491189-57491211 AAACAGAAATAGGAAGAAGCAGG - Intronic
1149641523 17:58205992-58206014 AATCAGAAAGACGAAGAGGCAGG + Exonic
1149773390 17:59339038-59339060 AAGCAAAAACAGAAAGAGCAAGG - Intronic
1149863683 17:60138800-60138822 AAGCTGAAACAGCCAGAAGGTGG + Intergenic
1150484402 17:65533708-65533730 AAGCAGCAGCCGCAAGAGGGAGG - Intronic
1150644385 17:66968804-66968826 AAAGAGAAAGAGGAAAAGGGAGG - Intronic
1150947323 17:69762103-69762125 AAGCAGGAACTGGAAGAAAGAGG - Intergenic
1150995673 17:70314881-70314903 AAAAAAAAACTGGAAGAGGGAGG - Intergenic
1151159552 17:72153376-72153398 GAGCAGAAAGTGGAAAAGGGGGG + Intergenic
1151427399 17:74040073-74040095 GTGCAGAAGCAGGAAGAGTGAGG + Intergenic
1151632124 17:75318313-75318335 AAGCAGGATGAGGAAGAGTGAGG + Exonic
1152053893 17:78006599-78006621 AAGAAGAAGAAGGAAGAAGGAGG - Intronic
1152228009 17:79101659-79101681 AAGGAGAGAGAGGAAGAGGGAGG + Intronic
1152339406 17:79716019-79716041 CAGCAGAAGCCGGGAGAGGGTGG + Intergenic
1152497309 17:80682594-80682616 CACCAGAAACTGGAAGAGGCCGG + Intronic
1152682141 17:81674043-81674065 AAGCAGCAGCTGGAAGGGGGTGG + Intergenic
1152731674 17:81975110-81975132 GAGAAGAAAGAAGAAGAGGGAGG - Intergenic
1153173083 18:2338868-2338890 AGGAAGCAACAGGAAGAGGCAGG + Intergenic
1153560024 18:6362289-6362311 AGAAAGAAAGAGGAAGAGGGAGG + Intronic
1153568994 18:6449425-6449447 GAGCAGAGGCAGGAAGTGGGTGG - Intergenic
1154285722 18:13054605-13054627 ATGAAGAAACAGGTTGAGGGAGG - Intronic
1154496907 18:14968098-14968120 TAGGAGAAACAGGAAGATGATGG - Intergenic
1155125027 18:22865836-22865858 AAGCATAAACAGTAGGAGGCAGG - Intronic
1155153966 18:23143262-23143284 AAGCACAGGCAGGCAGAGGGCGG - Intronic
1155178830 18:23325385-23325407 AAGGAGAGAAAGGCAGAGGGAGG + Intronic
1155472492 18:26205472-26205494 AAGAAGAAAGAAGAAGAAGGAGG + Intergenic
1155558936 18:27053774-27053796 AAGCAGAAACAGCATGAATGGGG - Intronic
1155589787 18:27413633-27413655 AAAGAGAAAGAGAAAGAGGGAGG + Intergenic
1155682217 18:28502229-28502251 AAGGAGACACAGGAATAGGGTGG + Intergenic
1155961549 18:31999662-31999684 AAGAAAAGACAGGAAGAGGCCGG - Intergenic
1156782831 18:40871511-40871533 AAGAAGAGATAGGAAGTGGGAGG - Intergenic
1156966493 18:43100363-43100385 AAGTAGAGAGAGCAAGAGGGAGG + Intronic
1157807185 18:50666792-50666814 AAGCAGAAAGTGTATGAGGGAGG - Intronic
1158610127 18:58932175-58932197 AAGCACAAGGAGAAAGAGGGAGG - Intronic
1158637066 18:59168783-59168805 CAGCTCAAACAGGAAGATGGCGG + Intergenic
1158835881 18:61331726-61331748 AAGGAGAAGGAGGAAGAGGGAGG - Intergenic
1159122113 18:64183094-64183116 AAGCAGAAGAAGGAAAAGAGAGG - Intergenic
1159271237 18:66153807-66153829 AAGAAGAAAGACGAAGAAGGAGG + Intergenic
1159356520 18:67343464-67343486 AAGCAGGAACTGGAGGAGGGAGG + Intergenic
1159516585 18:69466764-69466786 AAGTAGGAAAAGTAAGAGGGAGG + Intronic
1159951866 18:74489971-74489993 AAAGAGAAAGAGAAAGAGGGAGG + Intergenic
1160950836 19:1666515-1666537 AAGGAGAAGAAGGAAGAAGGAGG - Intergenic
1161024941 19:2032418-2032440 AAGAAGAGACTGGAAGAGGGCGG + Intronic
1161192915 19:2969239-2969261 CACCAGAAACTGGAAGAGGCAGG + Intergenic
1161347856 19:3777062-3777084 AGGCAGGAGCAGGAAGAGAGGGG + Intergenic
1161438643 19:4278774-4278796 GAGCAGCAGAAGGAAGAGGGGGG - Exonic
1162080490 19:8214966-8214988 GAGGAGAAAAAGGAAGAGGAGGG + Intronic
1162080503 19:8215008-8215030 GAGGAGAAAAAGGAAGAGGAGGG + Intronic
1162103047 19:8352188-8352210 AAGAAGAAAGAAAAAGAGGGAGG + Intronic
1162123688 19:8487712-8487734 CTGCTGAAACAGGAAGCGGGAGG - Intronic
1162444816 19:10716343-10716365 ATGGAGAAAGAGGAGGAGGGTGG - Intergenic
1162581609 19:11534644-11534666 AAGAAGAAAGAAGAAGAAGGAGG + Intergenic
1162742548 19:12781828-12781850 AAAAAAAAACAGGAACAGGGAGG - Intronic
1162792050 19:13068262-13068284 AAACAGCAGAAGGAAGAGGGGGG + Intronic
1162846881 19:13399703-13399725 AAGCAGAAAAAGAAAGGTGGAGG - Intronic
1162864908 19:13538351-13538373 AAGCAGAAGCTGGGAGGGGGAGG + Intronic
1163237954 19:16040203-16040225 AAGCAGAGACAGCAAGTGGCGGG - Intergenic
1163387247 19:17007405-17007427 AAGAAGAAGCAGGAGGAGAGGGG + Intronic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1163571815 19:18086773-18086795 CAGCAGGAAGAGGAAGAGGAGGG + Exonic
1163609316 19:18292824-18292846 AAGCTGAAGCAGGAAGGGGAGGG - Intergenic
1164249795 19:23466689-23466711 AAGGAGAAAGAGGAGGAGAGGGG - Intergenic
1164426294 19:28144946-28144968 AAGAAGAAAGAGGATGAGAGAGG - Intergenic
1164570072 19:29367858-29367880 AAGCAGAAGGAGGAGGCGGGAGG - Intergenic
1164645212 19:29854295-29854317 ACTCAGAAGGAGGAAGAGGGTGG + Intergenic
1164718639 19:30415046-30415068 AAGCAGAAGCAGGAAGAAGAAGG - Intronic
1164940623 19:32250368-32250390 AAGTAGAAAGTGCAAGAGGGTGG + Intergenic
1165395803 19:35563047-35563069 AGGCAGAAAAGGAAAGAGGGAGG - Intronic
1165416043 19:35694124-35694146 AGGGAGGAAGAGGAAGAGGGAGG - Intergenic
1165511758 19:36270267-36270289 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165512308 19:36272768-36272790 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165512855 19:36275309-36275331 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165513411 19:36277864-36277886 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165513960 19:36280398-36280420 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165514513 19:36282935-36282957 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165515064 19:36285468-36285490 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165515615 19:36288004-36288026 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165516166 19:36290541-36290563 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165516716 19:36293067-36293089 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165517269 19:36295590-36295612 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165517821 19:36298125-36298147 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165518374 19:36300660-36300682 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165518924 19:36303192-36303214 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165519473 19:36305707-36305729 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165520021 19:36308235-36308257 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165624046 19:37270346-37270368 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165624592 19:37272887-37272909 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165625135 19:37275414-37275436 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165625669 19:37277952-37277974 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165626209 19:37280477-37280499 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165626750 19:37283004-37283026 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165627290 19:37285525-37285547 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165627831 19:37288053-37288075 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165628368 19:37290577-37290599 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165628908 19:37293102-37293124 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165629451 19:37295628-37295650 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165629992 19:37298153-37298175 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165630535 19:37300681-37300703 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165631071 19:37303219-37303241 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165658521 19:37554414-37554436 TAGCAGAGAAAGGAATAGGGAGG - Intronic
1165690911 19:37862507-37862529 AAGAAGAAAGAAGAAGAAGGAGG + Intergenic
1165873513 19:38989648-38989670 AAGGAGAAAGAGAGAGAGGGAGG - Intergenic
1166365939 19:42278554-42278576 CAGCCAAAACAGAAAGAGGGTGG - Intronic
1166377460 19:42335505-42335527 AGGCAGAAACAGGGAGAAGTAGG - Intronic
1166540866 19:43604820-43604842 ATGGAGAAAAAGGAACAGGGTGG - Intronic
1166625520 19:44350127-44350149 GAGCAGAAAAAGGCAGAGGTTGG + Intronic
1166635236 19:44445449-44445471 GAGCAGAATGAGAAAGAGGGAGG - Intronic
1166944684 19:46389808-46389830 AAGCAGGAGCAGGAAGGGGCAGG - Intronic
1167073695 19:47235996-47236018 AAGAAGAAAAAAGAAGAAGGAGG - Intergenic
1167333118 19:48868585-48868607 AAAGAGAAACTGGGAGAGGGAGG - Exonic
1167406178 19:49310200-49310222 GAGCAGGGACAGGAAAAGGGAGG + Intronic
1167608236 19:50493112-50493134 ATGCAGAGACAGGAACAGAGTGG + Intergenic
1167622051 19:50566149-50566171 AAGATGCTACAGGAAGAGGGAGG + Intronic
1167643023 19:50692530-50692552 AAGCAGAAGCAGGAACAGGGTGG - Intronic
1167666272 19:50824083-50824105 AAGCAGAAACAGGAAGACGGAGG + Intergenic
1167690577 19:50982173-50982195 CAGCAGAAGCAGGAAGAGCGGGG + Intronic
1167701169 19:51046949-51046971 GGGCAAAAACAGGAAGAGGAGGG + Intergenic
1168075522 19:53979048-53979070 AGGCAGAAAAAAAAAGAGGGGGG + Intronic
1168098299 19:54127926-54127948 AAGAAGAAAAAGAAAGGGGGTGG + Intronic
1168236448 19:55066674-55066696 AAGGAGAGAGAGGAAGAGGAAGG - Intronic
1202654351 1_KI270708v1_random:5453-5475 AAGAAGAAGCAGGAAGCTGGGGG + Intergenic
1202696063 1_KI270712v1_random:127486-127508 CAGCAGAAACTGGAAGAGGCTGG + Intergenic
925071914 2:976486-976508 AAGAAGAAACAAGGACAGGGAGG - Intronic
925571021 2:5312801-5312823 AAGCAGAGACAGGCAGAGCTGGG + Intergenic
925882408 2:8363800-8363822 CAGCAGAGACAGGAAGGAGGAGG - Intergenic
926406201 2:12555443-12555465 AAGCAAAAATAGGAAGGGGTGGG + Intergenic
926410936 2:12601939-12601961 ACACAGAAACAGAAAGAGTGAGG - Intergenic
926420503 2:12692101-12692123 TACCAGAAACAGGAAGAGGCAGG - Intergenic
926574842 2:14568882-14568904 AAGCCAAAAAAGGAAGAAGGGGG + Intergenic
926906428 2:17809969-17809991 CAGCAGACACAGCAAGAGGATGG - Intergenic
927709338 2:25315141-25315163 AAGCAGAACCAGGAACTGGAAGG - Intronic
927854991 2:26522438-26522460 AAGCTGGGACAGGAAGAGGTAGG + Intronic
928090241 2:28369341-28369363 GAGCAGAAAAGGGAAGAGAGAGG - Intergenic
928204907 2:29277016-29277038 AAGGAGAGAGAGGAAGAGAGAGG + Intronic
928251805 2:29687283-29687305 AAGCAGAAAGAGGTAGGGGGTGG + Intronic
928634797 2:33233606-33233628 AGACAGAAAAAGGAAAAGGGTGG - Intronic
928765690 2:34642501-34642523 AAACAGAAACAGAAAGAGAAAGG + Intergenic
928921812 2:36534580-36534602 AGGGAGAGACAGGAAGAGGGAGG + Intronic
928933152 2:36646071-36646093 AGCCAGAAACAGGAAAAGCGTGG + Intronic
929171391 2:38936393-38936415 AAACAGAAAGAGGAGGAGGAAGG - Intronic
929470003 2:42182310-42182332 AAGCAGAAACCAGTGGAGGGGGG - Intronic
929863799 2:45700837-45700859 AGGCAGATGCAGGGAGAGGGCGG + Intronic
929904054 2:46030556-46030578 CAGAAGTAACAGCAAGAGGGAGG - Intronic
931125973 2:59276644-59276666 ACCCAGGAGCAGGAAGAGGGAGG + Intergenic
931705866 2:64945557-64945579 AAGGAAAAAAGGGAAGAGGGAGG - Intergenic
931852513 2:66265994-66266016 AAGCTGAAACATGTAGAGAGTGG + Intergenic
931867722 2:66430577-66430599 AAACAGAAATAAGAGGAGGGAGG - Intergenic
932401870 2:71486300-71486322 AAGCAGAGAGAGCCAGAGGGTGG - Intronic
932498313 2:72158619-72158641 ACGCAGAAACAGGGACAGGAAGG - Intergenic
932599861 2:73116187-73116209 AAACAGAAGCAGGAAGAGCTTGG + Intronic
932827378 2:74954309-74954331 CAGAAGAAACAGGAAGACGAAGG - Intergenic
933513482 2:83270951-83270973 AAGCTGGAAGGGGAAGAGGGAGG - Intergenic
933769098 2:85731938-85731960 AAGCCTAATGAGGAAGAGGGAGG - Intergenic
934080436 2:88463120-88463142 AAGCTGAAACTGGGAGATGGAGG + Intergenic
934277231 2:91584522-91584544 CAGTAGAAACTGGAAGAGGCTGG + Intergenic
935143607 2:100378026-100378048 AGGGAGAAACAGAAAGAGGTAGG - Intergenic
935379359 2:102435306-102435328 AAGTGGAAACAGAAAGAAGGTGG + Intronic
935388947 2:102530423-102530445 AGGCAGAAAAAGGAAGAGTGAGG - Intronic
935403406 2:102683730-102683752 AAAGAGAAACAGGAGGATGGAGG - Intronic
935505603 2:103898374-103898396 AAGTAGAAAGAGAAAGAAGGAGG + Intergenic
935948119 2:108304407-108304429 AAGCAGAGACAGAAAGAAGAGGG + Intronic
936073465 2:109386575-109386597 AAGCAGAAACACAGAGAGGTGGG - Intronic
936081327 2:109434562-109434584 ACTCAGAAGCAGGAAGAGGGTGG - Intronic
937061701 2:118984736-118984758 AAGCAGGGGCAGGCAGAGGGTGG + Intronic
937319627 2:120953337-120953359 CAACAGAAACTGGAAGAGGCGGG + Intronic
937524711 2:122754371-122754393 AAGCAGAAAAGGGATGAGGAAGG - Intergenic
937616162 2:123924296-123924318 AAGCAGAAATTGGAAGAGTTTGG - Intergenic
937941022 2:127286152-127286174 GAGCAGCAAAAGGAAGATGGAGG + Intronic
938064519 2:128273803-128273825 AAACAGAAGCAGGAAGAGGGCGG + Intronic
938212947 2:129483851-129483873 GAGCAGAAAGAGGAAAATGGGGG - Intergenic
938675852 2:133633126-133633148 AAGATGACACAAGAAGAGGGGGG + Intergenic
939046457 2:137256022-137256044 AAAAAAAAACAGGAAGAAGGGGG - Intronic
939113454 2:138034023-138034045 GAGAAGAAACAGAAAGATGGTGG + Intergenic
939288888 2:140167881-140167903 AAGCAGAAACTGACAGGGGGAGG + Intergenic
939291313 2:140198923-140198945 AAGGAGAAAAAGAAAGAAGGAGG + Intergenic
939335407 2:140820889-140820911 AAGAAGCAACAGAAAGAGGAGGG - Intronic
939931659 2:148241792-148241814 AGGCAGAAATAGAAAGAGTGAGG - Intronic
940924990 2:159354812-159354834 AAGCAGAAGAAAGAAGAGGAAGG + Intronic
941388045 2:164877490-164877512 AACCAGAACCATGATGAGGGTGG + Intergenic
941447881 2:165624873-165624895 AAGAGGAAACAGGCAGAGAGAGG + Intronic
941492854 2:166163825-166163847 AAGCAGAAACCAGAAGAGTGAGG - Intergenic
942683658 2:178508435-178508457 AAGCAGAAACATGGTGGGGGAGG - Exonic
943291314 2:186075562-186075584 AAGGAGAAGGAGGAAGAGGAGGG - Intergenic
943600904 2:189919862-189919884 AGGCAGATAGAGGAAGAGGATGG - Intronic
943707995 2:191056370-191056392 AAGAAGCAACAGGATGAGGCTGG + Intronic
943716262 2:191155389-191155411 AAACAGAGAGAGGAAGAGAGAGG + Intergenic
943814031 2:192228533-192228555 AAGCAGAAATGAGAAAAGGGGGG + Intergenic
944157490 2:196622572-196622594 AGAAAGAAACAGAAAGAGGGAGG - Intergenic
944227639 2:197364188-197364210 AAGGTGGGACAGGAAGAGGGTGG - Intergenic
944253334 2:197599505-197599527 AAGGAGAAAGAGGAAGGAGGTGG + Intronic
944384145 2:199145735-199145757 AAGCAGAAAGCAGAAGAGGGTGG + Intergenic
944980585 2:205115224-205115246 AATCAGAACCAGGAAAAGGAAGG - Intronic
945005519 2:205401020-205401042 AAGAAGAAAGAGGATAAGGGTGG + Exonic
946004582 2:216512637-216512659 AAGCGGACAGAGGTAGAGGGAGG + Intronic
946007243 2:216535797-216535819 AAGCAGAATCCGGAAGTTGGGGG - Intronic
946098103 2:217292832-217292854 AAGCAAAAACAGAAAGAGGGAGG - Intronic
946143819 2:217713781-217713803 AAGTAGAAACAGGGATTGGGGGG + Intronic
946270376 2:218587416-218587438 AAAAAAAAAAAGGAAGAGGGCGG - Intronic
946289551 2:218733746-218733768 AATCCAAAAGAGGAAGAGGGAGG - Intronic
946724293 2:222647050-222647072 AAGAAGCAAGAGGAAGAGGCAGG - Intronic
946739036 2:222783819-222783841 AGGCAGAATAAGGGAGAGGGTGG - Intergenic
946773920 2:223117877-223117899 ATGGAGACACAGGAAGAAGGAGG + Intronic
946863982 2:224026167-224026189 AACCACAGACAGGAAGAGGCTGG + Intronic
947231194 2:227888389-227888411 AAGCAGAAGCAGGATCAGGCGGG + Intronic
947909204 2:233790541-233790563 AAGGAGAAAAAGAAAGGGGGAGG - Intronic
947924157 2:233906424-233906446 AAGCAGAGACTGGAACATGGTGG - Intergenic
947952006 2:234156235-234156257 AAGAAGAAAAAGAAAGAGGAGGG - Intergenic
948281033 2:236748205-236748227 GAGCAGAAACAGGAGAAAGGAGG - Intergenic
948535950 2:238646946-238646968 AGGAAGAGACAGGTAGAGGGAGG + Intergenic
948541505 2:238694224-238694246 GAGGAGAAAGAGGAAGAGGGAGG + Intergenic
949047271 2:241877763-241877785 AAGAAGGACCAGGAAGGGGGTGG - Intergenic
1168832121 20:851784-851806 AGGCAGATACAGGATGAGGTGGG - Intronic
1169004024 20:2192093-2192115 GAGCAGAGACAGCAACAGGGAGG - Intergenic
1169063931 20:2682099-2682121 AAGAAGAAAGAAGAAGAGAGGGG + Intergenic
1169352833 20:4883415-4883437 TAGCAGCAATATGAAGAGGGTGG - Intronic
1169448992 20:5695434-5695456 AAGGAGAAAAAAGAAGAAGGAGG - Intergenic
1169825629 20:9765654-9765676 AGGGAGAAGCAGGGAGAGGGCGG - Intronic
1169828022 20:9790988-9791010 GAGCAGAAACAGGAGAAGGAAGG - Intronic
1169986697 20:11453014-11453036 AGAGAGAAACAGGAAGAGGTAGG + Intergenic
1170190624 20:13641363-13641385 AGGTGGGAACAGGAAGAGGGAGG - Intergenic
1170348507 20:15414637-15414659 AAGGATAACCAGGAAGAGGCTGG - Intronic
1170700084 20:18695651-18695673 AGGAAGAAACAGAAAAAGGGAGG - Intronic
1171533059 20:25864696-25864718 GAGCAGAAGGAGCAAGAGGGAGG + Intronic
1171544505 20:25990034-25990056 GAGCAGACAGAGCAAGAGGGAGG - Intergenic
1173021101 20:39268857-39268879 AAGCACGAACAGGAAGAGTTAGG - Intergenic
1173238221 20:41267714-41267736 GAGCAGAAACCTGAAGAAGGAGG + Intronic
1173262244 20:41446819-41446841 ACGCAGAGGAAGGAAGAGGGTGG + Intronic
1173761563 20:45565073-45565095 AGGAAGAAAGAGAAAGAGGGAGG + Intronic
1174544714 20:51316777-51316799 ATGCAGAACAAGGAAGAAGGAGG - Intergenic
1174670992 20:52307546-52307568 AAGCAGAAAAAGCAGAAGGGTGG - Intergenic
1175531143 20:59674818-59674840 AGGCAGAAACAGGAGAAGTGGGG - Intronic
1175563650 20:59954837-59954859 AGGCAGAGCCTGGAAGAGGGAGG - Intergenic
1175590952 20:60191568-60191590 GAATAGACACAGGAAGAGGGAGG - Intergenic
1175821140 20:61909551-61909573 CAGCAGAACCCGGAAGAGGCAGG - Intronic
1175844057 20:62049421-62049443 AGACAGAATCAGAAAGAGGGCGG - Intronic
1176552141 21:8229603-8229625 ACGCAGAAAAAGAAAGAGAGAGG - Intergenic
1176552529 21:8233929-8233951 ACGCAGAAAAAGAAAGAGAGAGG - Intergenic
1176571031 21:8412184-8412206 ACGCAGAAAAAGAAAGAGAGAGG - Intergenic
1176571434 21:8416520-8416542 ACGCAGAAAAAGAAAGAGAGAGG - Intergenic
1176578958 21:8456745-8456767 ACGCAGAAAAAGAAAGAGAGAGG - Intergenic
1176579348 21:8461082-8461104 ACGCAGAAAAAGAAAGAGAGAGG - Intergenic
1176633281 21:9160958-9160980 AAGAAGAAGCAGGAAGCTGGGGG - Intergenic
1177358912 21:20044452-20044474 AAACAGAAATAGAAAGTGGGAGG - Intergenic
1177369797 21:20187409-20187431 AAGAAGAATCTGGAAAAGGGTGG - Intergenic
1177650611 21:23956527-23956549 AAGCAAAACCAGGAATAAGGGGG - Intergenic
1178198327 21:30374352-30374374 AAAAAGAAAAAGAAAGAGGGAGG - Intronic
1178256267 21:31055196-31055218 AAACAGAAAAAGGAAGGAGGGGG + Intergenic
1178474017 21:32920577-32920599 GAGCAGACGCAGGGAGAGGGCGG + Intergenic
1178636870 21:34311526-34311548 AAGCAGAAATTGGAAGTGGTTGG - Intergenic
1179016728 21:37600365-37600387 AAGCAGAGAAAGGAAGCTGGAGG - Intergenic
1179035055 21:37752551-37752573 AGGCAGAAAGAGGAATAGAGAGG + Intronic
1179187418 21:39095724-39095746 ATGCAGTAACAGGCAGAGTGAGG + Intergenic
1179257589 21:39730133-39730155 TAGCAGAAGCAGGAAGAAGCAGG - Intergenic
1179401445 21:41087813-41087835 CACCAGAAACTGGAAGAGGCAGG - Intergenic
1179488611 21:41726587-41726609 AAGGAGAAAGAAGAAGAAGGGGG - Intergenic
1179514559 21:41897753-41897775 AAGCAAAGACAGGGAGAGAGGGG + Intronic
1179523748 21:41962120-41962142 AAAAAAAAACAGGAAAAGGGTGG + Intergenic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1179829608 21:43988364-43988386 AAGAAGAGACATGAAGAGGATGG - Intergenic
1180081459 21:45489613-45489635 AAGCAGTGGCAGGAAGAGCGGGG - Intronic
1180389144 22:12208972-12208994 AAGAAGAAGCAGGAAGCTGGGGG - Intergenic
1180416797 22:12725499-12725521 AAGAAGAAGCAGGAAGCTGGGGG + Intergenic
1181012954 22:20052922-20052944 CGGCAGAGACAGGAAGAGTGAGG + Intronic
1181324238 22:22032561-22032583 AAGCTGACACATGAAGAGGATGG - Intergenic
1181375580 22:22455208-22455230 AGGCAGAAAGAGAGAGAGGGAGG + Intergenic
1181627731 22:24133064-24133086 AAGGAGAGACAGGCAGAGGAGGG - Intronic
1181779144 22:25180248-25180270 AAGAAGAAACAGGCAGGGCGTGG + Intronic
1182119331 22:27776596-27776618 GAGGAGAAAGAGGGAGAGGGTGG - Intronic
1182554271 22:31120520-31120542 ATGCTGAAACAGGCTGAGGGTGG - Intergenic
1182590656 22:31377147-31377169 ATACAGAAACAGAAGGAGGGGGG + Intergenic
1182735409 22:32529397-32529419 AAGCAGAAACAGTAAAGGTGGGG + Intronic
1182792355 22:32963681-32963703 AAGCAGAGAGAGGAAAAGAGAGG + Intronic
1182838039 22:33360491-33360513 GAGCAGCAAGAGAAAGAGGGAGG + Intronic
1183064984 22:35356610-35356632 GAGCAGAAATAGGAAGAAGCTGG + Intergenic
1183130435 22:35829560-35829582 AAAAAGAAACAGAGAGAGGGAGG + Intronic
1183336194 22:37248174-37248196 AGGGAGAAACAGGGAGAGGTGGG - Intergenic
1184050092 22:41997945-41997967 AGGTGGAGACAGGAAGAGGGTGG - Exonic
1184300037 22:43553275-43553297 GAGCAGAACCAGGAGGAAGGAGG + Intronic
1184379433 22:44135868-44135890 ACACAGAAACAGACAGAGGGAGG - Intronic
1184429575 22:44433973-44433995 CACCAGAAACTGGAAGAGGCAGG + Intergenic
1184448709 22:44570149-44570171 AAGCAGAAAGAGAAAAGGGGAGG - Intergenic
1185311810 22:50160224-50160246 AAAAAGAAACAGGAGGTGGGGGG - Intronic
1203257148 22_KI270733v1_random:146492-146514 ACGCAGAAAAAGAAAGAGAGAGG - Intergenic
1203257522 22_KI270733v1_random:150624-150646 ACGCAGAAAAAGAAAGAGAGAGG - Intergenic
949229375 3:1732439-1732461 AAGGGAAAACAGGAAGATGGAGG - Intergenic
949250078 3:1973133-1973155 AAGAAGAAAGAAGAAGAAGGAGG + Intergenic
949310444 3:2691390-2691412 AAGAAGAAAGAGGAAGAGGAGGG + Intronic
949329740 3:2908475-2908497 AAGCAGAATAAGGAAGAAGGAGG + Intronic
949366255 3:3284825-3284847 AAGAAGAAAGAAGAAGAAGGAGG - Intergenic
949376078 3:3391816-3391838 GAGCAGAAACCTGAAGAGTGTGG - Intergenic
949495562 3:4628453-4628475 AAGGTGAAACAGGATGAGAGAGG - Intronic
949890720 3:8731993-8732015 AAGAAGAAAGAGGAAGGGGCAGG - Intronic
950154815 3:10713556-10713578 AAGAAGTAAAAGGAAGAAGGTGG + Intergenic
950309118 3:11940381-11940403 AGGAAGTCACAGGAAGAGGGAGG - Intergenic
950347099 3:12306424-12306446 ATGAAGAAACAGGAACAGAGAGG + Intronic
950484474 3:13264915-13264937 AGACAGAAACAGAAAGAGAGAGG - Intergenic
950575931 3:13832069-13832091 AAGCAGGAGCAGGAACAGGAGGG - Intronic
950611521 3:14130109-14130131 AAGGAGAAAAAGAAAGAGAGAGG - Intronic
950768349 3:15290914-15290936 AGGCAGAAACAGGAAGTGGCTGG + Intronic
950845546 3:16012086-16012108 AAGAAGGAAAAGAAAGAGGGAGG + Intergenic
951501493 3:23392511-23392533 AAACAGGAAGAAGAAGAGGGAGG + Intronic
951543870 3:23806723-23806745 AAGCCGAAACAGGGGGACGGAGG - Intronic
951681283 3:25297353-25297375 AAGCAACATCAGGAATAGGGAGG - Intronic
951887886 3:27541648-27541670 AAACAGAAACAGTAAGATGTAGG - Intergenic
951902233 3:27668156-27668178 CAGCAGGAACAGGAAGAGAAAGG + Intergenic
952013938 3:28934428-28934450 AAGAAGGAACAGTAAGAGGGAGG + Intergenic
952193646 3:31049758-31049780 AAGAAGAAACAAGAAGAAAGAGG - Intergenic
952544721 3:34406653-34406675 AAGCTGGTACAGGAAGAGGGAGG - Intergenic
952647621 3:35680777-35680799 AAGAAGAAAGAGAAGGAGGGAGG - Intronic
953121169 3:40044057-40044079 AAGCAGAAGCTGGATGAGGAAGG + Exonic
953175416 3:40547241-40547263 AAGAAGAAAGAGAGAGAGGGAGG - Intronic
953237628 3:41120211-41120233 AAACAGAAACAGAAGGAAGGAGG - Intergenic
953806543 3:46074719-46074741 AAGGAGGAAGAGGAAGAGGAGGG + Intergenic
953933642 3:47020804-47020826 AAGCAGAACCAGGAGATGGGTGG - Intronic
953957646 3:47244145-47244167 ATGCAGAAACAGGCACAGAGCGG + Intronic
954015594 3:47687382-47687404 CAGAAAAAACAGGAAGAGGCTGG + Intronic
954100125 3:48365737-48365759 AAGCAAAAAGAAGAAGAGGAGGG + Intergenic
954643735 3:52117978-52118000 AAGAACAGACAGCAAGAGGGTGG + Intronic
954715410 3:52524372-52524394 AAGCAGAAGCATGCACAGGGAGG + Exonic
955459278 3:59162883-59162905 AAGTAGAAACAGGTAGATGATGG + Intergenic
955488618 3:59460392-59460414 AGGGAGAAACAGGAAAAGGAAGG - Intergenic
955602702 3:60664437-60664459 AAGGAGGAAGAGGAAGAAGGGGG - Intronic
955662275 3:61313946-61313968 AAGCAGATACAGGAAAAGGTGGG + Intergenic
955772369 3:62398270-62398292 AAGAAGAAATAGGAAAGGGGAGG - Intergenic
955964717 3:64377122-64377144 AAGCAGACAGAGAAAGGGGGAGG + Intronic
956018253 3:64907311-64907333 AGGAAGAAACTGGAAGATGGAGG - Intergenic
956082027 3:65567534-65567556 AAGAAGAAAGAGGAAAAGGATGG + Intronic
956202630 3:66722314-66722336 AAGAAGAAGGAGAAAGAGGGAGG - Intergenic
956214447 3:66833926-66833948 CAGCAGAAAGAGGGAGAGTGGGG + Intergenic
956223624 3:66931684-66931706 AAGAAGAAAAAGGAAGAAGGTGG - Intergenic
956338331 3:68190571-68190593 GAGCAAAAACAGGAAGACTGAGG - Intronic
956761598 3:72448633-72448655 AAGAAGGAAGAGGAAGAGAGAGG + Intergenic
957070309 3:75562732-75562754 AGGCAGAACCAGGAAAAGGATGG + Intergenic
957165805 3:76672226-76672248 AAGCAGAAAAATGAAGAGCAAGG + Intronic
957608727 3:82439383-82439405 AAACATAAGCAAGAAGAGGGAGG - Intergenic
957830396 3:85509230-85509252 GGGCAGTAGCAGGAAGAGGGTGG + Intronic
958028894 3:88083048-88083070 AAGAAGAGGGAGGAAGAGGGAGG - Intronic
958085753 3:88804206-88804228 AATGAGAATCAGGCAGAGGGAGG + Intergenic
959581401 3:107986619-107986641 AAGAAAAAACAGTAAGAGGCTGG + Intergenic
960504820 3:118479685-118479707 AGGAAGAGAGAGGAAGAGGGAGG - Intergenic
960537482 3:118829157-118829179 AAGAAGAAACAAAAAGAGGGAGG + Intergenic
960967287 3:123114152-123114174 CAGGCGAAACAGGAAGAGAGAGG + Intronic
961360937 3:126366663-126366685 AAGCAGAGACCGGTGGAGGGTGG - Intergenic
961460269 3:127045590-127045612 AGGGAGAGAGAGGAAGAGGGAGG + Intergenic
961492781 3:127266771-127266793 AAGCAGGAACAGGGAGGGGCAGG - Intergenic
961515681 3:127433004-127433026 AAGCAGTAACAAGAGGAGGATGG + Intergenic
961702145 3:128753347-128753369 AAGCAGATAGAGGATGAAGGGGG + Intronic
961790088 3:129369370-129369392 AAGCAGAAAGAGAAAGAGTTTGG + Intergenic
961830026 3:129618617-129618639 CAGCAGAGAGAGGAAGTGGGAGG - Intergenic
961914334 3:130356038-130356060 ATGCAAAAAAAGGAAGAGGAGGG - Intronic
962075459 3:132076976-132076998 AAGCAGGAAGGGAAAGAGGGGGG - Intronic
962163984 3:133029687-133029709 AAGAAGAAACAGAAAGAACGTGG + Intergenic
963088973 3:141464181-141464203 AAGCAGAACAAAGAAGAAGGTGG - Intergenic
963336050 3:143973602-143973624 AATCAGAAACAGGAAAAGTAAGG + Intronic
963592834 3:147285427-147285449 GAGAAGAAAGAGGAAGAGGAGGG - Intergenic
963831423 3:150013538-150013560 AAACAGAAACATGGAGAAGGAGG - Intronic
963957768 3:151274385-151274407 AAGTGAAAAAAGGAAGAGGGAGG - Intronic
964246782 3:154663095-154663117 AAGGAGAAACAGTAAGAAAGAGG - Intergenic
964322931 3:155516881-155516903 AAGCAGGAACAAGTAGAGAGGGG + Intronic
964399998 3:156288940-156288962 AAACAAAGAAAGGAAGAGGGAGG - Intronic
964737129 3:159928680-159928702 AAGCAGAATGAAGAAGAGGAAGG + Intergenic
964769928 3:160213447-160213469 TTGCAGAAACAGGAAGAGCTAGG - Intergenic
965039519 3:163488626-163488648 CAGGAGAAAGAGGAAGAAGGGGG + Intergenic
965727676 3:171736316-171736338 AAGAGGAAACAGGAACAGAGAGG + Intronic
966025964 3:175282474-175282496 AAGGAGAAAGAGGAAGAGGGAGG + Intronic
966055785 3:175687831-175687853 AAGCAGAAACAAGAGAAAGGTGG - Intronic
966168961 3:177055657-177055679 AAACAGAATAAGGATGAGGGAGG + Intronic
966319894 3:178690532-178690554 AAGAAGGAAGAGAAAGAGGGAGG + Intronic
966714715 3:183003813-183003835 CAAGAGAAACAGGTAGAGGGAGG - Intergenic
967442747 3:189527888-189527910 AAGCACACATAGGAAGAGGCTGG + Intergenic
967483022 3:189996466-189996488 AGGGAGAGACAGGAAGAGGTTGG + Intronic
967842145 3:194014645-194014667 GAAAAGAAACAAGAAGAGGGAGG + Intergenic
968144705 3:196288253-196288275 GGTCAGAAAAAGGAAGAGGGTGG - Intronic
968827051 4:2906310-2906332 AAGGGGAGACAGGAAGAAGGGGG - Intronic
968969565 4:3786556-3786578 AAGCAGAGAGAGAAAGAGGAGGG + Intergenic
969033514 4:4231840-4231862 AAGCAGAAACTGGAAGAGGCTGG - Intergenic
969211804 4:5693504-5693526 CACCAGAAGCTGGAAGAGGGAGG + Intronic
969218659 4:5744754-5744776 CATCACAAACAGGAAGAGGCTGG + Intronic
969270281 4:6095003-6095025 AAAAATAAAAAGGAAGAGGGAGG + Intronic
969308708 4:6339909-6339931 AAGCAGAAGAAGGACGATGGGGG + Intronic
969348542 4:6584376-6584398 AGGCAGTAAAAGGAAGAGAGGGG + Intronic
969561194 4:7949531-7949553 AAGGGGAAAGAGGAAGAGGAAGG - Intergenic
969727187 4:8927300-8927322 AAGGAGAAACAGGAGGGGTGCGG - Intergenic
969936516 4:10687514-10687536 AAGCAGGAAAGGGAAGAGGAGGG + Intergenic
970195577 4:13547597-13547619 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
970214678 4:13746188-13746210 TAGCAGACACATGAAGTGGGTGG + Intergenic
970573488 4:17405264-17405286 AAGGAGGAAGAGGAAGAGGAAGG + Intergenic
971413887 4:26404825-26404847 AAGTAGACACAGGAAGTGGGAGG - Intronic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972237817 4:37154370-37154392 AAGCAGCAACGGGAAGCAGGGGG + Intergenic
972980982 4:44700827-44700849 TATCAGAACCTGGAAGAGGGAGG - Exonic
973026048 4:45272585-45272607 AAGCAGAAATGGGGAGAGGGAGG + Intergenic
973314978 4:48750162-48750184 AAGAAAAAAAAGGAAGAGGCTGG + Intronic
973881451 4:55275382-55275404 GAGCAGAAGGAGGAAGAGGAGGG + Intergenic
974274369 4:59698187-59698209 AAGGAGAATGAGGAAGAGGAGGG + Intergenic
974307218 4:60157246-60157268 AAGCAGAAAAAGTAAGAAGATGG - Intergenic
974866852 4:67591722-67591744 AAGTAGAAAAAGGAACAGTGTGG + Intronic
975455377 4:74584378-74584400 AAGCAGTAGTAGGCAGAGGGAGG + Intergenic
975470687 4:74762624-74762646 AAGGAGAATGAGAAAGAGGGTGG + Intronic
975705038 4:77103443-77103465 AAGCAGAAACAGGCAGGGCGCGG + Intergenic
975723486 4:77270279-77270301 AAGCAGGACCAGGGAGAGGAAGG + Intronic
975725863 4:77291119-77291141 AAGCAGGACCGGGCAGAGGGAGG + Intronic
976299978 4:83508034-83508056 GAGCAGAAAAATGAAGTGGGGGG + Intronic
976448378 4:85158658-85158680 AAGCAAGCAAAGGAAGAGGGAGG - Intergenic
976527211 4:86107571-86107593 AAGGAGAAACAGGAGAAGGGGGG + Intronic
976608142 4:87001828-87001850 AAGCAGACACAGGAAGAGGGAGG - Intronic
977116354 4:93033680-93033702 AAACAGAAACAAGGAGAGAGAGG - Intronic
977270274 4:94909651-94909673 ATGTAAAATCAGGAAGAGGGAGG - Intronic
977349671 4:95866151-95866173 AATCAAAAACAGGAAAAAGGAGG - Intergenic
977866512 4:102034799-102034821 AACCAGGAAGAGGAAGAGGCAGG + Intronic
978096423 4:104784499-104784521 AAGCAGATACAGGGAAAGGATGG - Intergenic
978133344 4:105226644-105226666 AAAAAGAGAGAGGAAGAGGGAGG - Intronic
978389115 4:108206072-108206094 AAAAAGAAAGTGGAAGAGGGAGG - Intergenic
978466622 4:109015974-109015996 CAGCAGGGACAGGAAGAGGCAGG + Intronic
978608322 4:110507480-110507502 AGGCAGAAACAGATACAGGGAGG - Intronic
978827997 4:113047775-113047797 CTGCTGAAACAGGAGGAGGGTGG + Intronic
978835350 4:113142722-113142744 ATGAAGAAAAAGAAAGAGGGGGG + Intronic
978852298 4:113353749-113353771 AAGCAGAAACAAAAAGAGGAAGG + Exonic
979126993 4:116985819-116985841 AAGGATAACCAGGTAGAGGGAGG + Intergenic
979131209 4:117047539-117047561 AAGGAGAAGCAGGAAGAGAGGGG - Intergenic
979471879 4:121108638-121108660 AATCAGAAACTGGAAGAGTGGGG - Intergenic
979665732 4:123309001-123309023 AAATAGAAAAAGGAAGCGGGTGG - Intronic
979993162 4:127399827-127399849 AAAGAGAAAAAGGAAGAGGTTGG + Intergenic
980354272 4:131723706-131723728 GGGCAGACACAGCAAGAGGGAGG - Intergenic
980354809 4:131726212-131726234 GGGCAGACACAGCAAGAGGGAGG - Intergenic
980355344 4:131728689-131728711 GGGCAGACACAGCAAGAGGGAGG - Intergenic
980355893 4:131731190-131731212 GGGCAGACACAGCAAGAGGGAGG - Intergenic
980356428 4:131733681-131733703 CGGCAGACACAGCAAGAGGGAGG - Intergenic
980357507 4:131738661-131738683 GGGCAGACACAGCAAGAGGGAGG - Intergenic
980358577 4:131743641-131743663 GGGCAGACACAGCAAGAGGGAGG - Intergenic
980359120 4:131746114-131746136 GGGCAGACACAGCAAGAGGGAGG - Intergenic
980360198 4:131751077-131751099 GGGCAGACACAGCAAGAGGGAGG - Intergenic
980361284 4:131756032-131756054 GGGCAGACACAGCAAGAGGGAGG - Intergenic
980362367 4:131760987-131761009 GGGCAGACACAGCAAGAGGGAGG - Intergenic
980362907 4:131763470-131763492 GGGCAGACACAGCAAGAGGGAGG - Intergenic
980378376 4:131977522-131977544 GGGCAGACACAGCAAGAGGGAGG + Intergenic
980560737 4:134471039-134471061 AAGCAGAAACATATAGATGGTGG + Intergenic
980841060 4:138261913-138261935 AAGAAGAAACAGGAGGAGGGAGG - Intergenic
981188154 4:141829931-141829953 TAGCAGAAGGAGGAAGAGGAAGG - Intergenic
981572873 4:146172055-146172077 AAGAAGGAAAAGAAAGAGGGAGG - Intergenic
982065788 4:151653381-151653403 AAGGAGAGAGAGGGAGAGGGAGG - Intronic
982074672 4:151726816-151726838 AGGCAAAGACAGGAAGAGGATGG - Intronic
982640835 4:157958087-157958109 ATGCAGAAAGAGAAAGTGGGAGG - Intergenic
982740890 4:159055752-159055774 AAACAAAAACACGAAGAGTGAGG + Intergenic
982934760 4:161458641-161458663 AAGCAGAAACAGAAAGAAAATGG - Intronic
982943075 4:161583257-161583279 ACAGGGAAACAGGAAGAGGGAGG - Intronic
983112467 4:163769940-163769962 GAGGAGAAAAAGGAAAAGGGGGG - Intronic
983203477 4:164887282-164887304 AAGAAGGAAGAGGAAGATGGGGG - Intronic
983206497 4:164915817-164915839 AAGCAAGAAGAGGAAGAGGCAGG + Intergenic
983212126 4:164969729-164969751 AAGCAAGAAGAGGAAGAGGCAGG - Exonic
984276407 4:177616529-177616551 AAACAAAAACAGGAAGAGAGAGG + Intergenic
984419111 4:179496850-179496872 AAGGAGAAAGAGGAGGAGGTGGG + Intergenic
984430723 4:179645382-179645404 TATCAAGAACAGGAAGAGGGTGG - Intergenic
984765351 4:183396576-183396598 AAACAGAAACAGGAAGGAAGTGG - Intergenic
984786655 4:183573485-183573507 AAGGAGGAAGAGGGAGAGGGAGG + Intergenic
985155671 4:186984842-186984864 GAGGTGAAACAGGACGAGGGAGG - Intergenic
985168343 4:187121810-187121832 AAGTAGAAGGAGGAAGAGGAGGG + Intergenic
985211690 4:187602658-187602680 AGGCAGAAACAGGCAAAGGCAGG - Intergenic
985619043 5:944045-944067 AAGCAGACACAGAGAGAGGGAGG + Intergenic
985816743 5:2133060-2133082 AAGCAGACACTGGAAGGTGGGGG - Intergenic
985832741 5:2247446-2247468 AAGAAGAAACAGGAGGAGAAGGG - Intergenic
986070632 5:4279058-4279080 AAGGAGAAAAAGTGAGAGGGGGG - Intergenic
986284871 5:6351711-6351733 TAGCAGGCAGAGGAAGAGGGTGG + Intergenic
987032852 5:13991503-13991525 AAGGAGAAGGAGGAAGAGGAGGG + Intergenic
987062367 5:14254644-14254666 GAGAAGAAACAGGAGGAGGAGGG - Intronic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
987185394 5:15412196-15412218 AAGCAGAGAAAGGAAGAATGTGG + Intergenic
987427217 5:17786971-17786993 TAGCAGAGATAGGGAGAGGGAGG - Intergenic
987518907 5:18953269-18953291 AAACAGAAATAGGAAAAGGGAGG - Intergenic
987611984 5:20216868-20216890 AAGCAGAAAGAGCAAGAGCAAGG + Intronic
987976587 5:25022480-25022502 AAGTAGAAATAGGGAGAGGAAGG + Intergenic
988272543 5:29035071-29035093 AAGCAGAAACAGTAAGTCAGAGG - Intergenic
988276648 5:29089631-29089653 AAGAACAAAAAGGAAGAAGGAGG - Intergenic
988283454 5:29180166-29180188 AAGAAGAAACAAGAAGGGGGAGG + Intergenic
988479824 5:31620311-31620333 AAGCAGAACTGGGCAGAGGGAGG + Intergenic
988492775 5:31718573-31718595 AAGCAGACACAGCAAGAAGGTGG - Intronic
988718727 5:33854691-33854713 AAGCAGAAAGACAAAAAGGGAGG + Intronic
989483726 5:41963725-41963747 AAGGAGGAGCAGGAAGAGGAAGG + Intergenic
989784055 5:45305744-45305766 AAGAAGAAACAGAAGAAGGGAGG + Intronic
990526483 5:56633170-56633192 AAGGAGGAGCAGGAGGAGGGAGG + Intergenic
990573889 5:57106359-57106381 AAGAAGAAAGAAGAAGAAGGAGG + Intergenic
990895439 5:60695328-60695350 AAGCGGAAGCAGGCAGAAGGAGG + Intronic
991231683 5:64340918-64340940 AAGGAGGTAAAGGAAGAGGGAGG - Intronic
991584811 5:68191169-68191191 AACAAGAGACAGGGAGAGGGAGG + Intronic
991963479 5:72068283-72068305 AGGCAGCAACCTGAAGAGGGAGG - Intergenic
992070211 5:73141344-73141366 AAGAAGAGACACGAAGAGTGTGG - Intergenic
992090686 5:73313145-73313167 AAGAAGAAAGAAGAAGAAGGAGG - Intergenic
992097393 5:73375665-73375687 AAGAACAAGCAGGAAGAGGAAGG + Intergenic
992270846 5:75061485-75061507 AAGCAGAAACAAAATGGGGGAGG - Intergenic
993183175 5:84581780-84581802 AAGCAGGAAAAGGGAGAGGAAGG - Intergenic
993573525 5:89572347-89572369 AATCAGAACCATGTAGAGGGCGG - Intergenic
993644512 5:90445811-90445833 AGGAAGAAACTGGAAGAGGAGGG + Intergenic
994034063 5:95178314-95178336 AAGCAGGATCAGGCAGTGGGTGG - Intronic
994345542 5:98681256-98681278 AAGCAGAAAAAGCAAGGAGGTGG + Intergenic
994817892 5:104607966-104607988 AAGCAGAAACAAGGAAAGGTTGG + Intergenic
994895282 5:105695278-105695300 AAGCAGTGACGGGAAGAGGAGGG + Intergenic
994913680 5:105945620-105945642 AAGAAGAAGAAAGAAGAGGGAGG + Intergenic
994956668 5:106541731-106541753 AAGAAGTAGGAGGAAGAGGGAGG - Intergenic
995165405 5:109034146-109034168 CAGCAGAAACAGGAGGTGTGAGG - Intronic
995261744 5:110112242-110112264 AAGAAGAAAAGGGATGAGGGTGG + Intergenic
995272886 5:110242430-110242452 AAGCAGGAGCAGGAGGAGTGGGG + Intergenic
995324501 5:110875214-110875236 AAACACAAAAAGAAAGAGGGAGG - Intergenic
995690571 5:114821921-114821943 AAGTAGAAAAAAAAAGAGGGAGG - Intergenic
995735886 5:115298542-115298564 AAGAAGAAAAAGAAAGAAGGAGG + Intergenic
995930865 5:117441238-117441260 AAGCAAAACCATGAAGAGAGTGG - Intergenic
996136070 5:119843955-119843977 AAGGAGAAAAAGAAAGAGAGAGG - Intergenic
996909358 5:128637438-128637460 AGACAGAAAGAGAAAGAGGGAGG + Intronic
997091161 5:130860269-130860291 AAGCAGCAGTAGGATGAGGGAGG - Intergenic
997506534 5:134421993-134422015 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
998092421 5:139379134-139379156 AAGCACACACAGGAACGGGGTGG - Intronic
998262355 5:140641185-140641207 GAGCAGAAACCTGAAGAGAGTGG + Intronic
998936720 5:147236795-147236817 AATCAGAAAGAGAAAGAGGAAGG - Intronic
998985187 5:147748959-147748981 ATGCAGACACACGAAGAGTGAGG - Intronic
999322496 5:150624298-150624320 AAGGAGAGCCAGGAAGAGGTAGG + Intronic
999744407 5:154580765-154580787 AAGGGGAAACAGGAATAGGACGG + Intergenic
999801553 5:155042884-155042906 AAGCAGAGCCAGGAAGAGTAGGG - Intergenic
1000111991 5:158117054-158117076 AAAGAGAAAGAGGAAGAGGAAGG - Intergenic
1001094568 5:168766296-168766318 AAGCAGAAAGAGGAATTGGGGGG + Intronic
1001108407 5:168875306-168875328 AAGAAGAAAGAGGAGGAAGGAGG + Intronic
1001185098 5:169563271-169563293 AAGCTTAAAAAGGAAGTGGGAGG - Intergenic
1001543710 5:172557110-172557132 GAGCAGAAGCAGGAGGAGGGAGG - Intergenic
1002045873 5:176541624-176541646 AAGCAGAGGCAGGAAGAGGAGGG + Intergenic
1002193455 5:177490443-177490465 CAGGAGGAACAGAAAGAGGGAGG + Intronic
1002314527 5:178334439-178334461 AACCAGAGGCACGAAGAGGGTGG - Intronic
1002765256 6:233608-233630 AAACAGAGAGAGGCAGAGGGAGG + Intergenic
1002969088 6:1995823-1995845 AAGCAGGACCAGAAAGAGGGAGG - Intronic
1003254511 6:4462821-4462843 AAGGAAAAAGAGGAAAAGGGGGG + Intergenic
1003881945 6:10487184-10487206 AAGCAGAAACAAAACGAGGGAGG + Intergenic
1004184545 6:13410805-13410827 GAGGAGAAAGAGGAAGAAGGAGG + Intronic
1004205389 6:13587390-13587412 CAGCAGAAACTGGGAAAGGGAGG - Intronic
1004731456 6:18363517-18363539 AAGCAGAAAAAGCAAGGGGGTGG - Intergenic
1005509537 6:26500249-26500271 CAGCAGGAAAAGGAAGCGGGAGG - Intergenic
1005830954 6:29670779-29670801 AAGCAACAAGAGGAAGAGGCGGG + Intronic
1005911918 6:30318110-30318132 AAGCATATACAGGAAGATGCGGG + Intergenic
1006314663 6:33283228-33283250 ATGCAAAAACAGGGAGCGGGTGG + Intronic
1006729903 6:36228989-36229011 GAGCAGAAACAGGCAGAGGCTGG + Exonic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1008766050 6:54916219-54916241 AGGCAGAAAGAGAAAGAGGGAGG - Intronic
1009979292 6:70708107-70708129 GAGAGGAAACAGGAAGAGGGAGG - Intronic
1010036342 6:71329747-71329769 AAATAGATACAGGAATAGGGTGG - Intergenic
1010095437 6:72037795-72037817 AACCAAAAATAGGAAGAGTGAGG - Intronic
1010192373 6:73207553-73207575 AACCAGAGACAGGAGGAGGCAGG + Intergenic
1010410956 6:75560839-75560861 AAGGAGAAAGAAGAAGAAGGAGG + Intergenic
1010597729 6:77785448-77785470 TAGCAGAAAGAATAAGAGGGAGG + Intronic
1011400711 6:86958428-86958450 AAACAGAAACAGGAACAGACTGG - Intronic
1011484746 6:87829964-87829986 AAGGAGAAGGAGGAAGAAGGAGG - Intergenic
1011675745 6:89731808-89731830 AAGGAGAAAAAGGAAAAGGTGGG - Intronic
1011762198 6:90579337-90579359 AAGCAGAGACAGGCAGAGAAGGG - Intronic
1012754313 6:103205654-103205676 AAGAAGAAAGAAGAAGAAGGAGG - Intergenic
1012841144 6:104330629-104330651 AAGCAGAAACTGGAAATGGCAGG - Intergenic
1013284886 6:108672744-108672766 AAGAAGAAAGAGGATGAGAGAGG - Intronic
1013351703 6:109311796-109311818 AAGCAGAAAGAGGAAGGAGAGGG - Intergenic
1013420983 6:109966613-109966635 AGCCAGAAACAGGAAGGGGAAGG + Intergenic
1014785650 6:125615711-125615733 AAGAGGGAACAGGAAGATGGTGG - Intergenic
1015405650 6:132834303-132834325 AGCCAGAAAGAGGATGAGGGAGG + Intergenic
1015561922 6:134525274-134525296 AAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1015950678 6:138549490-138549512 CAGCAGAAGCTGGAAGAGGCAGG + Intronic
1017462963 6:154668398-154668420 AAGAAGAAAGAGGAGGAGGAAGG + Intergenic
1017898561 6:158701853-158701875 CACTAGAAGCAGGAAGAGGGAGG - Intronic
1018000713 6:159576258-159576280 CACCAGAAACTGGAAGAGGAAGG + Intergenic
1018182519 6:161236601-161236623 AAGCAGTAAAAGGAAAGGGGAGG + Intronic
1018204184 6:161421483-161421505 AAGCAGGACCAGCATGAGGGTGG + Intronic
1018228190 6:161650545-161650567 AAACAGAGACAGGGAGAGAGAGG + Intronic
1018279771 6:162172896-162172918 CAGAAGAAAGAGGAAGAAGGGGG + Intronic
1018297503 6:162364746-162364768 AAGGGGAATCAGGAAGAGGGAGG + Intronic
1018512286 6:164537964-164537986 AATTAGAAACAGGAAGAGAAAGG - Intergenic
1018564304 6:165135716-165135738 AAGCAGAAGTTGGAAGAGAGTGG + Intergenic
1019131382 6:169879387-169879409 ATGCAGAAACAGTGAGATGGGGG + Intergenic
1019484067 7:1280426-1280448 AAGAAGAAGAAGGAAGAAGGAGG + Intergenic
1019504099 7:1382008-1382030 AAGCAGAAGCTGGAAGTGGGGGG - Intergenic
1019535371 7:1526481-1526503 AAGGAGGAAGAGGAAGAAGGAGG + Intergenic
1020011532 7:4808161-4808183 AAGAAGATACAGGGAGAGAGGGG - Intronic
1020108288 7:5432980-5433002 AAGTAGAAAGATGTAGAGGGGGG + Intronic
1020786027 7:12573379-12573401 AAGGGGAAACAGGAAGAAGTTGG + Intronic
1020786308 7:12577552-12577574 AAGCAGAAACAAAAACAGGCCGG + Intronic
1021105329 7:16632056-16632078 AAGGAGAAAGAGAAGGAGGGAGG - Intronic
1021467339 7:20959997-20960019 AGGAAGAAACAGAAGGAGGGAGG - Intergenic
1022657263 7:32330950-32330972 AAGGAGACAGAGGAGGAGGGAGG - Intergenic
1023030494 7:36086604-36086626 CAGTAGCAAAAGGAAGAGGGAGG + Intergenic
1023047089 7:36219590-36219612 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023047096 7:36219639-36219661 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023567813 7:41540940-41540962 AGGAAGAAACAGGAGGAGGCTGG + Intergenic
1023769084 7:43538248-43538270 AGGGAGAAACTGGATGAGGGAGG + Intronic
1023879912 7:44312462-44312484 AAGGAGAGGGAGGAAGAGGGAGG + Intronic
1024127284 7:46312435-46312457 GAGAAGGAAAAGGAAGAGGGGGG + Intergenic
1024721003 7:52137363-52137385 AAGAAGAAGGAGGAGGAGGGGGG + Intergenic
1024940949 7:54762763-54762785 ATGCAGTAACCAGAAGAGGGTGG + Intergenic
1025887793 7:65614611-65614633 AAGGAGGAAGAGGAAGAAGGAGG - Intergenic
1026122912 7:67553051-67553073 AAGCAGAAAGATGGAGAAGGAGG - Intergenic
1026178299 7:68016867-68016889 AGGCAGTAACAGAAAGAGGAGGG + Intergenic
1026191869 7:68136285-68136307 AAGGAGAAAGAGAAGGAGGGGGG + Intergenic
1026229216 7:68468921-68468943 AAGAAGAAAAAGAGAGAGGGAGG + Intergenic
1026284985 7:68955124-68955146 AAGCAGAAAGAGAAAGAGAGGGG + Intergenic
1026494940 7:70893966-70893988 GAGAAGAGAGAGGAAGAGGGTGG + Intergenic
1026529522 7:71185046-71185068 AAGCAGAAGGAGGAGGAGGAGGG - Intronic
1026955050 7:74371738-74371760 AAGGACAAAGAGGGAGAGGGAGG + Intronic
1027171790 7:75878084-75878106 AAGAGGAAACAGGACTAGGGAGG - Intronic
1027182387 7:75949977-75949999 TCCCAGAAACAGGAGGAGGGAGG - Intronic
1027598924 7:80213829-80213851 AAAAAAAAACAGGAAGAGTGGGG - Intronic
1027615129 7:80413394-80413416 AAGAAGAAACAGACAGAAGGAGG - Intronic
1027991633 7:85370262-85370284 AAGCAGGGAAAGGAAGAGGAAGG + Intergenic
1028655967 7:93207444-93207466 AAGGAGAAAGAGGAGTAGGGAGG + Intronic
1028773329 7:94652350-94652372 AAAAAGAAAAAGGAAGAAGGTGG + Intronic
1029098770 7:98110087-98110109 AAGCAGAAAGAAGAACAAGGAGG - Intronic
1029155929 7:98518142-98518164 AAGCAGAGGCAGGAAGAATGTGG - Intergenic
1029187284 7:98748279-98748301 AAGGAGAAAGAGGGAGAGGCAGG + Intergenic
1029380493 7:100211240-100211262 AAACAGAAACAGCAAGATGGAGG - Intronic
1029451387 7:100643277-100643299 AAGCAGGAATATGAGGAGGGCGG - Exonic
1029624352 7:101710586-101710608 AAGCAGAAACAGGATGTGCCTGG + Intergenic
1029835143 7:103301514-103301536 AAGGAGAAACAGAAAAAGGAAGG + Intronic
1030172388 7:106616473-106616495 AAGGAGAGAGAGGAAGAGGAGGG + Intergenic
1030459325 7:109811447-109811469 AAGCAGAAAGATGAAAAGAGTGG - Intergenic
1030627077 7:111855978-111856000 CAGCTTAAACAGGAAGAGTGAGG + Intronic
1030681388 7:112437993-112438015 AAGAAGAAACAGGTAAAGAGTGG + Intronic
1031132876 7:117853270-117853292 AAAATGAAAAAGGAAGAGGGTGG - Intronic
1031648610 7:124258113-124258135 ATGCAGAAAAAGGTAGAAGGAGG - Intergenic
1031649840 7:124275281-124275303 AAGGAGAAACAGGAAGTTGATGG + Intergenic
1031838615 7:126709479-126709501 AAGAAGAAGAAGGAGGAGGGAGG + Intronic
1031854591 7:126907131-126907153 AAGGAGGAAGAGGAAGAAGGAGG + Intronic
1032210707 7:129911396-129911418 CAGAACAAACAGGATGAGGGAGG + Intronic
1032492394 7:132333385-132333407 AGCCAGGAAGAGGAAGAGGGAGG + Intronic
1032612701 7:133432703-133432725 TAGCAGAAACTGGAAGAGAGTGG - Intronic
1032799823 7:135309085-135309107 GAGAAGAAACAGGGAGAGAGAGG + Intergenic
1033586910 7:142780807-142780829 AAGCGGAGACAGGAGGAGGATGG - Intergenic
1033651440 7:143346588-143346610 AAGCAGGGACTGGAAGATGGAGG - Exonic
1033658047 7:143386552-143386574 AAGCAGAAACAGGAAGAGGGTGG + Intronic
1033832620 7:145271698-145271720 AAGAATAAGCAGGAAGAAGGAGG + Intergenic
1033952762 7:146805572-146805594 AGGAAGGAACAGCAAGAGGGAGG + Intronic
1033962109 7:146928033-146928055 AGGTAGAAACAGGAGGATGGAGG - Intronic
1034250477 7:149686594-149686616 AAGGTGAAACAGAGAGAGGGAGG + Intergenic
1034393345 7:150802033-150802055 AAGGAGAAAGAAGAAGAGGCAGG - Intronic
1034426023 7:151014423-151014445 ACTAAGAAACAGGAAGCGGGTGG - Exonic
1034452461 7:151144270-151144292 ATCCTGAAACAGGAAGAGGACGG + Exonic
1034680105 7:152922126-152922148 AAACAGCAAGAGGAAGAGGGAGG + Intergenic
1034680131 7:152922311-152922333 AAAAAAAAAAAGGAAGAGGGAGG + Intergenic
1034986430 7:155518286-155518308 GAGGAGGAAGAGGAAGAGGGTGG + Intronic
1036465230 8:8991292-8991314 AGACAGAAACAGTAAAAGGGAGG - Intergenic
1037121914 8:15298731-15298753 TAGGAGAAACAGGGAGTGGGAGG + Intergenic
1037396571 8:18449907-18449929 ATGAAGACACAGGAAGAAGGTGG - Intergenic
1037654531 8:20871909-20871931 GAGCAGAGAGAGGAATAGGGAGG - Intergenic
1037791440 8:21946031-21946053 TAGCAGAAACAGGAAAATGGAGG + Intronic
1038276487 8:26125732-26125754 AAGGAGAAAAGGGAAGAGGTCGG + Intergenic
1038812695 8:30866353-30866375 AAGGAGAAAGGGGAAGAGGAAGG + Intronic
1039099002 8:33920849-33920871 AAGTGGAAACAGAGAGAGGGAGG + Intergenic
1039422115 8:37451916-37451938 AAGCAGAAAAAAGAGTAGGGAGG - Intergenic
1039440792 8:37594087-37594109 AGGGAGAAAAAGGCAGAGGGAGG + Intergenic
1039510896 8:38091137-38091159 AAGCAGAAACTGGGAGTGTGTGG - Intergenic
1039556936 8:38483267-38483289 AAGCAGAAACAGGAAGAGGAAGG - Intergenic
1039566143 8:38553875-38553897 AAGCAGGAACAGAGGGAGGGGGG + Intergenic
1039635145 8:39156739-39156761 GTGCAGATACAGGGAGAGGGTGG - Intronic
1039806198 8:41001792-41001814 AAGAAGAAGAAGGAAGAAGGAGG - Intergenic
1039877458 8:41599135-41599157 AGGCAGCAACAGGAACATGGTGG - Exonic
1039895902 8:41716355-41716377 ATTCAGAAACAGGAAGTGGGGGG - Intronic
1040035210 8:42863317-42863339 GGGCAGAACCAAGAAGAGGGAGG + Intronic
1040104464 8:43533769-43533791 AAGGAGAGAGAGGAAGAGAGAGG - Intergenic
1040828818 8:51654419-51654441 AAGAAGAAATAGGGAGAAGGAGG - Intronic
1041268210 8:56085228-56085250 AAGCAGGAACAGGTTGGGGGTGG + Intergenic
1041294536 8:56341268-56341290 AAGCTGGAACAGGAAGAGCAGGG - Intergenic
1041401399 8:57448887-57448909 AAGAAGAAAGAAGAAGAAGGAGG - Intergenic
1041741832 8:61164737-61164759 ATACAGACACAGAAAGAGGGGGG - Intronic
1041770886 8:61471622-61471644 AAGCAAAGCCAAGAAGAGGGAGG + Intronic
1041802193 8:61812444-61812466 CAGCAGCATCAGAAAGAGGGTGG - Intergenic
1042171938 8:66000092-66000114 AAGGAGACACAGACAGAGGGAGG - Intergenic
1042497824 8:69475067-69475089 GAAGAGAAAGAGGAAGAGGGAGG + Intronic
1042839873 8:73112727-73112749 AAAGAGAAAGAGAAAGAGGGAGG - Intronic
1043256297 8:78141913-78141935 AAGGAGAAAGAGGAAGAAGATGG - Intergenic
1044067030 8:87711210-87711232 AAACAGAAAAAGGAACAGGTTGG + Intergenic
1045722834 8:105133785-105133807 CAACAGAAAGAGGAAGAAGGAGG - Intronic
1045828398 8:106428474-106428496 AAGCAAAAGGAGGAAGAGGTTGG + Intronic
1046286981 8:112106981-112107003 AAGAAGAAAAATGAAGAGGAAGG + Intergenic
1046581751 8:116101885-116101907 AGGGAGATAAAGGAAGAGGGAGG - Intergenic
1047250383 8:123177813-123177835 AAGCAGAAACTGGACAAGGTTGG + Intergenic
1047332796 8:123907298-123907320 AAGCAGACATAGGTACAGGGAGG + Intronic
1047452128 8:124974000-124974022 ATGCAAAAAAAGGAAGGGGGTGG - Intronic
1048042617 8:130745894-130745916 AGGCAGGAAGAGGAAGAGGAAGG + Intergenic
1048161120 8:132022970-132022992 AAGCAGAGACAGTGAGAGAGAGG - Intergenic
1048179207 8:132179995-132180017 GAGGAGAAACAGGAAGTGGCGGG - Intronic
1048235249 8:132683492-132683514 AAGACCAAAAAGGAAGAGGGAGG - Intergenic
1048260107 8:132938040-132938062 AGACAGAGCCAGGAAGAGGGAGG - Intronic
1048299076 8:133238466-133238488 AAGAGGAAACGGGAAGTGGGCGG + Exonic
1048550847 8:135432640-135432662 AAGCAGAAAGAGGCAGAGTAGGG - Intergenic
1048709649 8:137195159-137195181 AAAAAGAAAGAGGAGGAGGGAGG + Intergenic
1048878166 8:138852752-138852774 GAGGAGAACCAGGGAGAGGGAGG + Intronic
1049150962 8:141035255-141035277 AACCAGAAGCTGGAAGAGGCAGG + Intergenic
1049750959 8:144283713-144283735 AAGCAGCAACACCATGAGGGAGG + Intronic
1049786358 8:144452745-144452767 AGGCAGAAAAAGGGAGAGAGAGG + Intronic
1049825874 8:144667410-144667432 CTGCAGAGACAGGATGAGGGAGG - Intergenic
1050203841 9:3177273-3177295 AACCAGCAACTGGAAAAGGGGGG - Intergenic
1050475926 9:6041035-6041057 AAGGAGAAAGAGGAAGGAGGAGG - Intergenic
1050477107 9:6051522-6051544 AAGAAGAAAGAGGAAGAAAGAGG + Intergenic
1050593146 9:7180542-7180564 CAGCAGATATAGCAAGAGGGAGG + Intergenic
1050692184 9:8240581-8240603 AAACAGAAACAGAAACAGGTAGG + Intergenic
1050708971 9:8438042-8438064 AAGCAGGAAAAGAATGAGGGAGG + Intronic
1051100337 9:13513880-13513902 AAGCACTAACAGGAAGGGAGAGG - Intergenic
1051355422 9:16235689-16235711 AGCTAGAAACAGGAAGAGGAAGG - Intronic
1051522813 9:18009218-18009240 AAGAAGAAATAGGAAGATGAAGG - Intergenic
1051609632 9:18948624-18948646 AAGCACCATCAGGAGGAGGGAGG + Intronic
1051657320 9:19395542-19395564 AATGAGGAACAGGAAGAGGATGG - Intergenic
1052132268 9:24862764-24862786 AAGCAGAAACATGCAGATGATGG - Intergenic
1052243303 9:26301969-26301991 AAGGAGAAAGAGGAAGAGGGTGG - Intergenic
1052558856 9:30057252-30057274 GAGCAAAAACAGGAAGAGCAAGG - Intergenic
1052563926 9:30122152-30122174 AAGCAGAAGCAAGACAAGGGGGG + Intergenic
1052885752 9:33646857-33646879 AACCAGAAAGAGAAAAAGGGAGG + Intergenic
1053421116 9:37979258-37979280 AAGCAGAAACATTAACAGGATGG + Intronic
1054831286 9:69627937-69627959 AAGCATACACAGGAGGAGGGAGG - Intronic
1055989509 9:82090577-82090599 AGGAAAAAACAGGAAGAAGGAGG - Intergenic
1056270299 9:84940910-84940932 AAGGAGGCACCGGAAGAGGGAGG - Intronic
1056475057 9:86945757-86945779 AAGCAGCAGCAGCAAGATGGAGG + Exonic
1057171164 9:92964024-92964046 CAGCAGAAGCAGGAGGATGGTGG + Intronic
1057289894 9:93798895-93798917 AAGGAGAAAGAGAAAGAGGGAGG - Intergenic
1057446987 9:95123347-95123369 AAGCAGAAACAGGCTGGGTGTGG + Intronic
1057502799 9:95609230-95609252 AAGCAGAAAGAGGACAAAGGCGG + Intergenic
1057828658 9:98390583-98390605 AAGCAGACACAAGGAGATGGAGG + Intronic
1057962219 9:99467775-99467797 AAACAGAAACAAGAAGAGGAGGG + Intergenic
1058467762 9:105245375-105245397 AAGCAGAAACTGGAATTCGGTGG - Intronic
1058553962 9:106146460-106146482 AAGTAGTAAAAGGAAGAGAGAGG - Intergenic
1058726528 9:107810036-107810058 AAGAAGCCACAGGAAGAAGGAGG - Intergenic
1059361118 9:113742722-113742744 CAACAGAAGCAGGAAGAGGCTGG - Intergenic
1059585066 9:115597163-115597185 AAGGAGAAAGAGGAGGAGGAGGG - Intergenic
1059655152 9:116351055-116351077 AAGCAGGAAAAGGAAGAAAGGGG - Intronic
1059677464 9:116553119-116553141 AAGAAGAAAGAGGAGGAAGGGGG - Intronic
1060027512 9:120185463-120185485 AACCTGAGGCAGGAAGAGGGAGG - Intergenic
1060175297 9:121493188-121493210 AAGCAGGAAATGGAAGAGGCTGG - Intergenic
1061047900 9:128177211-128177233 AAGAGGAAACAGGCACAGGGTGG + Intronic
1061064066 9:128266602-128266624 AATCACAAACTGGCAGAGGGTGG - Intronic
1061242698 9:129383583-129383605 AAGCAGGAAAAGGAACTGGGGGG + Intergenic
1061348573 9:130045504-130045526 GAGGAGAAAGAGGAAGAGGAAGG + Intergenic
1061450334 9:130664047-130664069 AAGGAAAAACAGGAGGGGGGAGG + Intergenic
1061810108 9:133157420-133157442 AAACAGAACCAGTAAGAGGTAGG - Intronic
1061852195 9:133422817-133422839 AATCAGAGACAGGGAGAGGAAGG - Intronic
1061998699 9:134204831-134204853 AAGCTGAAACTGGAAGGGTGAGG - Intergenic
1062099936 9:134722821-134722843 AAGGAGAAAGAGGGAGAGGGAGG + Intronic
1062376591 9:136264522-136264544 ACGGAGAAACAGGAAAAGGCAGG - Intergenic
1062638411 9:137503594-137503616 AAGGAGAAGGAGGAAGAAGGAGG + Intronic
1203756122 Un_GL000218v1:128586-128608 AAGAAGAAGCAGGAAGCTGGGGG - Intergenic
1203473319 Un_GL000220v1:128203-128225 ACGCAGAAAAAGAAAGAGAGAGG - Intergenic
1203473709 Un_GL000220v1:132540-132562 ACGCAGAAAAAGAAAGAGAGAGG - Intergenic
1203649738 Un_KI270751v1:104834-104856 AAGAAGAAGCAGGAAGCTGGGGG - Intergenic
1185499165 X:584408-584430 AAGTAGAAGCAGGAAGAGTGGGG + Intergenic
1185499353 X:585159-585181 AGGGAGAAAAGGGAAGAGGGGGG + Intergenic
1185545366 X:939389-939411 AAGGAGAAAGAGAGAGAGGGAGG - Intergenic
1185627475 X:1492895-1492917 AACCAGAAAGAGGCAGAGGTGGG - Intronic
1185661991 X:1735428-1735450 GAGCAGAAAGAGAAGGAGGGAGG - Intergenic
1185662081 X:1735760-1735782 AGGGAGAAAGAGGAGGAGGGAGG - Intergenic
1185683976 X:1911699-1911721 AAGGAGAGAGAGGAAGAGAGAGG - Intergenic
1185717788 X:2356667-2356689 GAGGAGAAGGAGGAAGAGGGAGG - Intronic
1185814985 X:3146310-3146332 AAGAAGAAGAAGGAAGAGGGAGG - Intergenic
1185815175 X:3148337-3148359 GAGAAGAAAGATGAAGAGGGAGG + Intergenic
1185833711 X:3324780-3324802 GAGCAAGAACAGGAAGAGGATGG - Exonic
1185949364 X:4414318-4414340 AAGAAGAAACAGGAAGCATGGGG - Intergenic
1185989429 X:4876462-4876484 CAGTGGAAAGAGGAAGAGGGTGG + Intergenic
1186023093 X:5279100-5279122 AATCAGAGAAAGGAAGAGAGAGG + Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186072907 X:5842112-5842134 AAGCAGAAACAGGAGGGAAGGGG + Intronic
1186313163 X:8342079-8342101 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
1186336422 X:8594213-8594235 TAGCAGAGACAGAGAGAGGGAGG + Intronic
1186737612 X:12482083-12482105 AAGCAGGAAGAGGAAGAAGAGGG + Intronic
1187588772 X:20693027-20693049 AGGCTTAAACAGGAAGATGGTGG + Intergenic
1187746498 X:22414893-22414915 AAGGAAAGAAAGGAAGAGGGAGG - Intergenic
1187901215 X:24028270-24028292 AAGCAAAAACAGGAGGGAGGAGG - Intergenic
1187942004 X:24391639-24391661 ACTCAGAAACAGGAAAAGGGTGG + Intergenic
1188269294 X:28118875-28118897 AAGAAGGAAAAGGAGGAGGGGGG - Intergenic
1188338286 X:28966528-28966550 AAGCAACAACAAGAGGAGGGGGG - Intronic
1188451386 X:30310729-30310751 CAGCAAAAAAAGAAAGAGGGAGG - Intergenic
1188459346 X:30405440-30405462 ATGAAGATACAGGAAGAAGGTGG - Intergenic
1188466171 X:30483713-30483735 AAACAGAGAGAGAAAGAGGGTGG + Intergenic
1188609611 X:32079631-32079653 AAGAAAAAAAAGAAAGAGGGAGG + Intronic
1188878530 X:35462660-35462682 AACCAGACACAGCAATAGGGTGG + Intergenic
1189154321 X:38741417-38741439 AAGAAGAAAGAGAGAGAGGGAGG - Intergenic
1189294455 X:39908866-39908888 AAGCCGAGACAGCAAGAGAGTGG - Intergenic
1189602195 X:42639191-42639213 GAGGAGAAAGAGGAAGAGGAAGG - Intergenic
1189655570 X:43241022-43241044 GGGCAGAAACAGGAATAGGCAGG - Intergenic
1189828942 X:44950827-44950849 AAGGAGAAAAAGGAAAAAGGGGG - Intronic
1189911286 X:45812846-45812868 GAGCAGAAAGAAGAGGAGGGAGG + Intergenic
1190047480 X:47124281-47124303 AAGAAGAAAGAGAAAGAGGCCGG + Intergenic
1190755818 X:53400961-53400983 AAGCAGGGTCAGGAAGAAGGTGG - Intronic
1190877489 X:54470313-54470335 CAGCAGAAACAGGCAGCGGGAGG + Exonic
1191108383 X:56786616-56786638 AAGCAGAAAGAAGGAGAAGGAGG - Intergenic
1192267779 X:69551701-69551723 AGACAGAGAGAGGAAGAGGGAGG + Intergenic
1192267850 X:69552230-69552252 AACCAGCAACAAGAGGAGGGAGG + Intergenic
1192436444 X:71146106-71146128 GAGAAGAAAAAGGAAGAGGAGGG - Intronic
1192918355 X:75678876-75678898 AAAAAGAAAAATGAAGAGGGAGG + Intergenic
1193236484 X:79113624-79113646 AAGCAGAAGCAGGCTGAAGGTGG + Intergenic
1193655333 X:84190297-84190319 ACGCTGAAAAAGAAAGAGGGTGG - Intergenic
1194329468 X:92562956-92562978 AGACAGAAACTGGAAGAGTGTGG - Intronic
1194365806 X:93012175-93012197 AGGAAGAAAGAGGAAGTGGGAGG - Intergenic
1194559065 X:95397690-95397712 AAGGAGCAAGAGAAAGAGGGGGG - Intergenic
1194638915 X:96378514-96378536 AAGGAGAAACAAAAGGAGGGTGG + Intergenic
1194847734 X:98832528-98832550 AAGAAGAAAAAGGAGGAAGGAGG - Intergenic
1194898655 X:99478062-99478084 AAGCAGGAATGGGAAGAGGTTGG - Intergenic
1195032927 X:100944246-100944268 CAACAGAAACAAGAAAAGGGTGG + Intergenic
1195119771 X:101738454-101738476 AAGAAGAGAGAGGGAGAGGGAGG - Intergenic
1195310161 X:103624776-103624798 AAGCAGAAACAGAAAAGAGGAGG + Intronic
1195348905 X:103978550-103978572 AGGAAGAAAGAGGAAGGGGGTGG + Intergenic
1195358538 X:104060289-104060311 AGGAAGAAAGAGGAAGGGGGTGG - Intergenic
1195864840 X:109420238-109420260 AAGAAGAAAAAGAAAGAGAGAGG + Intronic
1195917871 X:109953533-109953555 AAACAGAAACAGGAAGGGCATGG + Intergenic
1196398684 X:115291478-115291500 AAGGAGAAGCAGGAACAAGGAGG + Intronic
1196601297 X:117604452-117604474 GAGCAGAAAGAGAGAGAGGGGGG - Intergenic
1197720685 X:129742570-129742592 AAGCACAGAAGGGAAGAGGGAGG + Intronic
1197947074 X:131851155-131851177 TAGCAGAAGCAGGAAGAGAGCGG - Intergenic
1198551114 X:137745847-137745869 AGGCAGAAACAGGCTGAGAGAGG + Intergenic
1198634591 X:138681796-138681818 AAGTAGAAACAGAGAGATGGGGG + Intronic
1199084616 X:143614525-143614547 TACCAGGAGCAGGAAGAGGGAGG + Intergenic
1199270837 X:145881298-145881320 AAGCAGGAAGAGACAGAGGGAGG + Intergenic
1199768100 X:150954954-150954976 AAGCAGCACCAGGAAGACTGAGG - Intergenic
1199777671 X:151029729-151029751 AAACAAAAACTGGAAAAGGGTGG + Intergenic
1199908250 X:152257783-152257805 AAGTTCAAAAAGGAAGAGGGAGG + Intronic
1200414211 Y:2890864-2890886 AAGGAGGAGAAGGAAGAGGGAGG + Intronic
1200638168 Y:5682146-5682168 AGACAGAAACTGGAAGAGTGTGG - Intronic
1200674028 Y:6128422-6128444 AGGAAGAAAGAGGAAGTGGGAGG - Intergenic
1200775208 Y:7164444-7164466 AAGCAGAAGAAAGCAGAGGGAGG - Intergenic
1200837976 Y:7751564-7751586 AACAAAAAACAGGATGAGGGAGG + Intergenic
1201146592 Y:11068049-11068071 AGGGAGAAGAAGGAAGAGGGAGG + Intergenic
1201146606 Y:11068098-11068120 AGGGAGAAGAAGGAAGAGGGAGG + Intergenic
1201300219 Y:12498670-12498692 AAGCAGCAGCAGGAGGAGGAGGG - Intergenic
1201461673 Y:14232559-14232581 AAGCAGAAGAAGGAAGGAGGAGG - Intergenic
1201516626 Y:14825241-14825263 AGGGAGAGACAGGAAGAGAGAGG - Intronic
1201541059 Y:15105445-15105467 AAGAAGAAAGAAGAGGAGGGAGG - Intergenic