ID: 1033658354

View in Genome Browser
Species Human (GRCh38)
Location 7:143388029-143388051
Sequence CCAGCACCACACAAATAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 195}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033658354_1033658367 -4 Left 1033658354 7:143388029-143388051 CCCTGTTATTTGTGTGGTGCTGG 0: 1
1: 0
2: 2
3: 22
4: 195
Right 1033658367 7:143388048-143388070 CTGGGGATGGCGGGGGTAGGGGG 0: 1
1: 0
2: 16
3: 91
4: 1036
1033658354_1033658371 17 Left 1033658354 7:143388029-143388051 CCCTGTTATTTGTGTGGTGCTGG 0: 1
1: 0
2: 2
3: 22
4: 195
Right 1033658371 7:143388069-143388091 GGACGAGGGAGAAGCTTTAAGGG 0: 1
1: 0
2: 0
3: 16
4: 143
1033658354_1033658369 3 Left 1033658354 7:143388029-143388051 CCCTGTTATTTGTGTGGTGCTGG 0: 1
1: 0
2: 2
3: 22
4: 195
Right 1033658369 7:143388055-143388077 TGGCGGGGGTAGGGGGACGAGGG 0: 1
1: 0
2: 3
3: 63
4: 764
1033658354_1033658370 16 Left 1033658354 7:143388029-143388051 CCCTGTTATTTGTGTGGTGCTGG 0: 1
1: 0
2: 2
3: 22
4: 195
Right 1033658370 7:143388068-143388090 GGGACGAGGGAGAAGCTTTAAGG 0: 1
1: 0
2: 1
3: 8
4: 143
1033658354_1033658366 -5 Left 1033658354 7:143388029-143388051 CCCTGTTATTTGTGTGGTGCTGG 0: 1
1: 0
2: 2
3: 22
4: 195
Right 1033658366 7:143388047-143388069 GCTGGGGATGGCGGGGGTAGGGG 0: 1
1: 0
2: 10
3: 106
4: 1146
1033658354_1033658364 -7 Left 1033658354 7:143388029-143388051 CCCTGTTATTTGTGTGGTGCTGG 0: 1
1: 0
2: 2
3: 22
4: 195
Right 1033658364 7:143388045-143388067 GTGCTGGGGATGGCGGGGGTAGG 0: 1
1: 0
2: 8
3: 98
4: 1103
1033658354_1033658368 2 Left 1033658354 7:143388029-143388051 CCCTGTTATTTGTGTGGTGCTGG 0: 1
1: 0
2: 2
3: 22
4: 195
Right 1033658368 7:143388054-143388076 ATGGCGGGGGTAGGGGGACGAGG 0: 1
1: 0
2: 4
3: 56
4: 638
1033658354_1033658365 -6 Left 1033658354 7:143388029-143388051 CCCTGTTATTTGTGTGGTGCTGG 0: 1
1: 0
2: 2
3: 22
4: 195
Right 1033658365 7:143388046-143388068 TGCTGGGGATGGCGGGGGTAGGG 0: 1
1: 0
2: 3
3: 47
4: 617

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033658354 Original CRISPR CCAGCACCACACAAATAACA GGG (reversed) Intronic
900327172 1:2114021-2114043 CACGCACCACACACACAACATGG - Intronic
900946010 1:5831846-5831868 CCAACACAACACAGAGAACACGG + Intergenic
903804210 1:25992745-25992767 TCAGCCCCACCCAAATCACAAGG - Intronic
905522352 1:38609938-38609960 CCAGCACCACAAATGTAAAATGG - Intergenic
905908733 1:41639315-41639337 CCAGCACCACAGAAGTAGCATGG + Intronic
906661435 1:47585546-47585568 TCAACACAACACAAAAAACATGG - Intergenic
910318749 1:85919768-85919790 CCTTCACCAGACAATTAACATGG + Intronic
912928763 1:113937430-113937452 CAAGGACCACACAGATAAAAAGG + Intronic
916453951 1:164951182-164951204 CCAGTACCAGACATATATCATGG + Intergenic
917452468 1:175158421-175158443 CCGGGACCATACAAGTAACATGG - Intronic
918669929 1:187202388-187202410 CTAGCACCACAGAAATAAATAGG + Intergenic
923079589 1:230641130-230641152 CCAGCAAAACAAACATAACAGGG + Intergenic
923233261 1:232008385-232008407 CCATCAACACACATATAACCAGG - Intronic
923300483 1:232635664-232635686 CCAGCACCTCACACAGAACCTGG + Intergenic
1063247561 10:4238145-4238167 CCAGCACCAAGCATATACCAGGG + Intergenic
1064348920 10:14558715-14558737 CCAGCTCCACACACTTAGCAAGG - Intronic
1065763637 10:29006931-29006953 GCAGCACCCCACAGATAACCAGG - Intergenic
1065965095 10:30764387-30764409 CCTGAACCCCACTAATAACACGG - Intergenic
1066084291 10:31961492-31961514 CCACGGGCACACAAATAACAGGG + Intergenic
1066335275 10:34470506-34470528 CCAGGGCCACATAGATAACAAGG - Intronic
1069545012 10:69321429-69321451 CCAGCCCCACAGGAAGAACAGGG - Intronic
1069643435 10:69972202-69972224 CTAGAACAACACAAATAGCAAGG - Intergenic
1071157228 10:82705228-82705250 TCAGCGACACACAAATCACATGG + Intronic
1073998969 10:109348331-109348353 CCTCCACCACAATAATAACATGG + Intergenic
1074793382 10:116915155-116915177 ACAGCACCCCCAAAATAACATGG + Intronic
1074799083 10:116980736-116980758 CCAGAAACAGACAATTAACATGG + Intronic
1074855678 10:117471736-117471758 CCATCACAACACAAGTGACATGG - Intergenic
1075289732 10:121218214-121218236 CCAGCATCACACTGATAGCAGGG + Intergenic
1076349323 10:129804950-129804972 CCAGACCCAAACAAATAAAAAGG - Intergenic
1078072653 11:8127525-8127547 CCAGAACCACACAAGTAAGTTGG - Intronic
1078699102 11:13663878-13663900 GAAGCACCACCCAAAGAACAGGG + Intergenic
1079984899 11:27190045-27190067 CCCCCACCACACCAATAACCTGG + Intergenic
1080406279 11:31982344-31982366 CCATCACCACAAAAAGAACATGG - Intronic
1080601180 11:33821706-33821728 CCAGGAACACACAAGCAACAAGG + Intergenic
1089153256 11:116381151-116381173 CCAGCAGCACAGAGATAACAGGG + Intergenic
1089271263 11:117303074-117303096 CCCCCACCACCCAAAAAACAGGG - Intronic
1089523652 11:119082443-119082465 GCAGCACCACCCAAATTACACGG - Intergenic
1089759400 11:120711999-120712021 ACAGCACCTCACAAAGAGCATGG - Intronic
1092862414 12:12730276-12730298 ACAGCATCTCACAAATAATATGG - Intronic
1093646883 12:21596260-21596282 CCAGCATCACACCAAAACCAGGG + Intronic
1093654662 12:21681071-21681093 CCACCACCACACAAAAGACTTGG - Intronic
1094015802 12:25862579-25862601 CCATAACCTCACAACTAACAAGG + Intergenic
1099693008 12:85984438-85984460 CCATCACCAAATAAATAAAAGGG - Intronic
1101634966 12:106532255-106532277 CCAGCATCACCCAAATAACCAGG - Intronic
1101685861 12:107019920-107019942 CCAGCACCAAACAAAAAAAAAGG + Intronic
1101891448 12:108719603-108719625 CCAGCACCAGAGAAATCATAGGG - Intronic
1102861768 12:116342285-116342307 CCAGAACCACACAAATTCTAGGG + Intergenic
1103823853 12:123720236-123720258 CATGAACCACACAAATAACTAGG - Intronic
1107357033 13:39578562-39578584 CCAGCACAACACAGAGGACACGG + Intronic
1108546770 13:51502876-51502898 CCACCATCACACAATTAACTTGG + Intergenic
1109272443 13:60269381-60269403 CCAGCATCTCACAAGCAACAAGG - Intergenic
1110736152 13:78939291-78939313 CCAGCACCAGACAATTAAATAGG + Intergenic
1111946864 13:94675156-94675178 CCAGCATCACACAGAGAGCAAGG + Intergenic
1112712935 13:102151282-102151304 CCAGCATCACATAATCAACATGG - Intronic
1117360493 14:54968215-54968237 TCAGAACCACACAAATTACATGG + Intronic
1117608144 14:57453356-57453378 CCAACCCCTCACATATAACAGGG - Intergenic
1120270013 14:82299856-82299878 ACAACACCACACATATAATATGG - Intergenic
1121238674 14:92412331-92412353 CCAGCCCCACCCAAATCATATGG + Intronic
1121736266 14:96220217-96220239 CCAGGACCACACAACTCTCAGGG - Intronic
1121773261 14:96571770-96571792 CTACCACTACTCAAATAACAGGG - Intergenic
1124504009 15:30256276-30256298 TCAGCCCCACACACAAAACATGG - Intergenic
1124739545 15:32282370-32282392 TCAGCCCCACACACAAAACATGG + Intergenic
1128452944 15:67817510-67817532 CCAGCCCTGCACAAATCACATGG - Intergenic
1128859757 15:71057988-71058010 ACAGAAACACACATATAACAGGG + Intergenic
1132333486 15:101028250-101028272 GCAGCAACACACATAAAACAAGG - Intronic
1133742618 16:8662871-8662893 CAAGCACCTAACATATAACAGGG + Intergenic
1134511716 16:14853846-14853868 CTAGCAGCCCACAAATGACAAGG - Intronic
1134699359 16:16252342-16252364 CTAGCAGCCCACAAATGACAAGG - Intronic
1134972470 16:18542330-18542352 CTAGCAGCCCACAAATGACAAGG + Intronic
1136078137 16:27830958-27830980 CCAGCCCCACACAAAACAAATGG - Intronic
1137733671 16:50708726-50708748 CCAGCACCACACACAGCTCAGGG - Intronic
1140956529 16:79871529-79871551 CCTGCCCCACCCCAATAACAGGG + Intergenic
1143361889 17:6377684-6377706 CCAGAACAACACAAATGACAGGG - Intergenic
1143824482 17:9593328-9593350 CCAGCAGCACACACATCACCTGG + Intronic
1144839116 17:18174806-18174828 CCAGCACCACTCCCATGACAGGG + Intronic
1146372548 17:32274542-32274564 GCAGCACCACACACCTCACAGGG - Intronic
1148497004 17:48059038-48059060 CCACAACCACACATACAACATGG + Exonic
1150605346 17:66686010-66686032 CCATCAACACACATATAACTGGG - Intronic
1151174585 17:72276643-72276665 CCAACACCACACTCATAATAGGG - Intergenic
1152523599 17:80874870-80874892 CCAGCACCCCGCTCATAACAAGG + Intronic
1152797578 17:82315692-82315714 CCAGCCCCAGACAAACAGCAGGG + Intronic
1153038400 18:786858-786880 ACAGAAACACACATATAACAAGG + Intronic
1153454806 18:5269291-5269313 AAAGCAAGACACAAATAACAAGG + Intergenic
1153504979 18:5787744-5787766 CCAGCACTACACAGGCAACAAGG + Intergenic
1153841168 18:9009283-9009305 CCAGTCCCCCACAGATAACAAGG + Intergenic
1154077257 18:11215612-11215634 CCAGCACCAGACCAAAGACATGG + Intergenic
1154966499 18:21362877-21362899 CCAGCAACAAACTAATGACAGGG - Intronic
1155443136 18:25882993-25883015 CCAGTTCCTCACAAATACCAAGG + Intergenic
1157522228 18:48353224-48353246 CCAGAATCACACCAATAACAAGG + Intronic
1164915363 19:32047589-32047611 CCAGGACCAGGCAGATAACAAGG + Intergenic
1167675084 19:50878868-50878890 TCTGCACCCCACAAACAACATGG - Exonic
925014275 2:510014-510036 ACAGCACCACATAAACCACATGG - Intergenic
926146802 2:10401239-10401261 CCAGCACCACACCAGGCACAGGG + Intronic
930154144 2:48088456-48088478 CCTCCACCCCACAAGTAACAAGG - Intergenic
931009760 2:57896799-57896821 CCACCACCAAAAAAATAAAAAGG + Intergenic
932021836 2:68095448-68095470 CCAGCACTCCACAAAAAGCAAGG - Intronic
935254734 2:101299721-101299743 CCATTACCACACAAAGAACGTGG - Intronic
936441904 2:112561623-112561645 ACAGAAACACACAAAAAACAAGG - Intronic
936830275 2:116636650-116636672 CCAACACCACAGAAATACAAAGG + Intergenic
938927222 2:136055076-136055098 CCACCACCACAAAAATCACTGGG - Intergenic
943745574 2:191458852-191458874 CCTGCACTACTAAAATAACAAGG - Intergenic
944437860 2:199710407-199710429 ACAGAAACACACATATAACAAGG + Intergenic
944538317 2:200733049-200733071 ACAGCCCCATACAAATAGCATGG + Intergenic
947578312 2:231294334-231294356 CCAGCACCAGAGAGACAACAGGG + Intronic
1170679433 20:18512474-18512496 CCAGCCCCAAGCAAATGACAAGG - Intronic
1173042833 20:39480827-39480849 ACATCACCATACAAATAAAAGGG - Intergenic
1174089311 20:48034431-48034453 CAAGCACCACAAAAATACCAGGG + Intergenic
1175140370 20:56856413-56856435 CCAGCACAACAACAAAAACATGG + Intergenic
1177274248 21:18887350-18887372 CCAGCAGCACAAAGATAAAATGG + Intergenic
1180257142 21:46638237-46638259 CCAGCATTACACACATAACAAGG - Intronic
1184347016 22:43919873-43919895 CCAGGAACACACATAAAACAAGG - Intergenic
1184703906 22:46197019-46197041 CCAAAACCAAACAAAAAACAGGG - Intronic
949709437 3:6857753-6857775 CCAGCACCACTTAAACTACATGG - Intronic
949936000 3:9116501-9116523 CAAGCCCCACACAACTCACATGG + Intronic
950769005 3:15295988-15296010 ACAGAAACACACATATAACAAGG + Intronic
952749482 3:36813822-36813844 CTAGCACTGTACAAATAACAGGG - Intergenic
952919504 3:38275190-38275212 CCACCACAACACAACTAACCTGG - Intronic
953290491 3:41656074-41656096 CCAGCACCCTACAAAAAACTGGG - Intronic
957911742 3:86626731-86626753 ACAGAAACATACAAATAACAAGG - Intergenic
958007985 3:87837500-87837522 CCAACTTCACACAAATCACAAGG + Intergenic
959008376 3:101046133-101046155 CCACCACCACACACACAAAATGG + Intergenic
959158444 3:102695209-102695231 CCAGCACCAACCAAGCAACAGGG + Intergenic
960424340 3:117487728-117487750 CGACCATCACATAAATAACAAGG - Intergenic
960483880 3:118227189-118227211 CCATAACAACAAAAATAACAGGG + Intergenic
960849738 3:122040163-122040185 CCAGAATTAAACAAATAACAAGG + Intergenic
963518991 3:146341386-146341408 CCACCACAACACAGATAACCTGG - Intergenic
964154630 3:153570063-153570085 CCAGCACCATTTAATTAACAGGG - Intergenic
964217621 3:154304568-154304590 CTACCACCACACAATTAAGATGG - Intronic
964376991 3:156057523-156057545 CCTGCACCACACACATAATAAGG + Intronic
965923282 3:173945477-173945499 CAAGCATCACACAAATAATATGG - Intronic
966102630 3:176291314-176291336 CCAGCACCACCCACATATCAAGG + Intergenic
966861204 3:184231644-184231666 CCAGCACCTCACACAGAACCTGG + Intronic
966950814 3:184815678-184815700 GCAGCACCACCAAAATCACATGG + Intronic
971774051 4:30937602-30937624 CCAGCATGACAGAAATAAAAGGG + Intronic
973555201 4:52075333-52075355 CCAGCACCACACTAATTACACGG - Intronic
975667671 4:76749062-76749084 CCAGGACCAGCCAAATAACATGG - Exonic
977393512 4:96444599-96444621 CCAGAGCCACACAAATAGCTAGG - Intergenic
977842558 4:101726128-101726150 CAAATACTACACAAATAACAGGG - Intronic
978739320 4:112119484-112119506 TCAGCACCACACAAACAACATGG - Intergenic
983262842 4:165475479-165475501 CCATGGGCACACAAATAACAAGG + Intronic
983575517 4:169257109-169257131 CAAGAGCCACACAGATAACAAGG + Intronic
988151823 5:27392931-27392953 CCAGAACCACAATAAAAACAAGG + Intergenic
990053504 5:51539054-51539076 CCAAAACCAGACAAAGAACATGG - Intergenic
992403982 5:76438402-76438424 CCAACACCACAGAAATACAAAGG - Intronic
992564669 5:77985726-77985748 CCAGAACCACTCATATCACATGG + Intergenic
992849513 5:80792781-80792803 CCAGCAACACATCAATCACAGGG - Exonic
992907124 5:81357535-81357557 CCAGCACCTCACGCATCACAGGG + Intronic
994577845 5:101603409-101603431 ACAGACCCACACAAATAACGTGG + Intergenic
995230549 5:109756628-109756650 CCAGCACCACTACAACAACACGG - Intronic
995965073 5:117895910-117895932 CTAGCACCACACACTTATCAAGG - Intergenic
996380061 5:122854118-122854140 CCAGCACTACACAGATGAAAGGG + Intronic
996709973 5:126534530-126534552 CCAGCTCCACACAGAAAGCAGGG + Intergenic
999180311 5:149665442-149665464 TCAGCCCCACCCAAATTACACGG - Intergenic
1001121495 5:168984555-168984577 CCAGCCCCACTGAAATATCAAGG + Intronic
1001649102 5:173302564-173302586 CCAGCCCCACCCTAATCACAGGG - Intergenic
1002013139 5:176300775-176300797 CCAGTGCCACAGAAATAAAAAGG + Intronic
1002214697 5:177621973-177621995 CCAGTGCCACAGAAATAAAAAGG - Intergenic
1006916455 6:37597160-37597182 CCAACACAACACATTTAACAAGG + Intergenic
1007957852 6:45933508-45933530 CCAGCACGTCACAGATACCAAGG + Intronic
1008125253 6:47660673-47660695 CCAGCTCCACATAGATCACATGG - Intronic
1011579464 6:88843421-88843443 GCAGCACTTAACAAATAACATGG + Intronic
1011692411 6:89882437-89882459 CCAACACCATACAAAAAAAAAGG - Intergenic
1011960078 6:93077640-93077662 CCAGCATGACACAGATAACTTGG - Intergenic
1012006711 6:93721589-93721611 CCAGCACCAAACAAACAAAATGG - Intergenic
1015014730 6:128398305-128398327 CCATCACCACTCAGAAAACAAGG + Intronic
1015295976 6:131593067-131593089 TGAGCTCCACACAAGTAACATGG + Exonic
1015438711 6:133221902-133221924 CCTACACCACACAACTAGCAAGG + Intergenic
1016313149 6:142756524-142756546 CCAAGATCACACAGATAACAAGG + Intronic
1017027241 6:150192219-150192241 CAAGTACAACACAAATAATATGG - Intronic
1018139296 6:160811977-160811999 CCAGAAACACACACAAAACAAGG - Intergenic
1018597027 6:165492034-165492056 ACAACACCACACAAATACAAAGG + Intronic
1020157600 7:5739241-5739263 CCACCACCACAAAAAAAGCATGG + Intronic
1022035995 7:26535105-26535127 AAACCACCACATAAATAACATGG - Exonic
1022577459 7:31511717-31511739 CCAACATCCCCCAAATAACATGG - Intergenic
1023968881 7:44977549-44977571 CCAGCCCCACCCAGATGACAGGG + Intronic
1024145470 7:46512193-46512215 CCAGCTCCACTCACATACCATGG - Intergenic
1026172842 7:67969581-67969603 CCAGCACCACTCCATAAACATGG + Intergenic
1027754678 7:82197585-82197607 CAAGCACTAAAGAAATAACAAGG + Intronic
1027820566 7:83037956-83037978 ACACCTCCACACAACTAACACGG - Intronic
1028124909 7:87101668-87101690 ACAGCAACAAATAAATAACAAGG - Intergenic
1028526062 7:91788286-91788308 CCAGCATCACACAGGTAGCAAGG - Intronic
1031424647 7:121590758-121590780 CCAACACCACCCAAATCAAAGGG + Intergenic
1031824570 7:126547035-126547057 CCAGCCTTACACAATTAACAAGG + Intronic
1032521327 7:132547682-132547704 CCAGAACCACAGAGAAAACAGGG + Intronic
1032880874 7:136089087-136089109 CCACCCCCACACAAAAAAGAGGG + Intergenic
1033400077 7:141014756-141014778 CGTGCATCACACAAATAACTTGG - Intronic
1033650956 7:143343103-143343125 CCAGAAACACACATACAACAAGG - Intronic
1033658354 7:143388029-143388051 CCAGCACCACACAAATAACAGGG - Intronic
1034150212 7:148909424-148909446 CCAGGATCACACAGCTAACAAGG + Intergenic
1036280657 8:7397779-7397801 CCAGCACCACACAATCACCATGG + Intergenic
1036283705 8:7424246-7424268 CCAGCGCCACACAATCATCATGG + Intergenic
1036337766 8:7887283-7887305 CCAGCGCCACACAATCATCATGG - Intergenic
1036340808 8:7913793-7913815 CCAGCACCACACAATCACCATGG - Intergenic
1036404321 8:8441412-8441434 CCAGCACCACACAAACCCCCTGG + Intergenic
1037431740 8:18820387-18820409 CCAGTACCCCACAGATACCAAGG - Intronic
1038221860 8:25616182-25616204 TCAGCACAACAAAAATCACAAGG + Intergenic
1038465376 8:27757681-27757703 CCAGCATCACACAACAAACAAGG + Intronic
1038514869 8:28179190-28179212 CCAGCCCCCCACATATAACAAGG + Intronic
1042770949 8:72381981-72382003 CTAGTACCACACAAAGAAAAGGG - Intergenic
1044615050 8:94131374-94131396 ACAGCAACACACAAAAAGCAAGG - Intronic
1044708041 8:95027162-95027184 CCCATTCCACACAAATAACATGG - Intronic
1045421518 8:102021546-102021568 CCAGAACCACAGTATTAACAGGG + Intronic
1047852186 8:128869055-128869077 CCAAGGCCACCCAAATAACATGG + Intergenic
1048680367 8:136834250-136834272 CCAGCTCCACACACTTAACATGG - Intergenic
1052747469 9:32454443-32454465 CCAGGACCACAGAGATAACAAGG + Exonic
1058719982 9:107755106-107755128 CTAGCACACAACAAATAACAGGG + Intergenic
1061855570 9:133440306-133440328 TCAGCTCCACACAGCTAACAGGG + Intronic
1062464337 9:136674535-136674557 CCAGCACCACCCATCTCACAGGG + Intronic
1189719518 X:43901192-43901214 CCACCACCACACACACACCATGG + Intergenic
1191161292 X:57331925-57331947 CCATCAACACACAAATATCCTGG - Intronic
1191226857 X:58053273-58053295 CCAGTACCACACTAAGCACAGGG - Intergenic
1192637426 X:72832618-72832640 CCACCACCACAGAAATAGCCAGG - Intronic
1192644288 X:72888196-72888218 CCACCACCACAGAAATAGCCAGG + Intronic
1193720933 X:84986761-84986783 CCAATCCCACACAAATACCAAGG - Intergenic
1194684140 X:96891012-96891034 CCACCACGAGACAAATAAGAGGG - Intronic
1194786994 X:98098049-98098071 CAACCAGCACCCAAATAACAAGG - Intergenic
1197359699 X:125485190-125485212 CCAGCATCACATACTTAACATGG + Intergenic
1197604272 X:128565892-128565914 CCATATTCACACAAATAACAAGG - Intergenic
1198464842 X:136895762-136895784 CACACACCAAACAAATAACAAGG + Intergenic
1198921754 X:141736741-141736763 CTTGCACCATACAAATAAGAAGG - Intergenic