ID: 1033658845

View in Genome Browser
Species Human (GRCh38)
Location 7:143390379-143390401
Sequence CACTAGGACCTTCCTGCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 109}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033658845_1033658859 21 Left 1033658845 7:143390379-143390401 CCTCTTGCAGGAAGGTCCTAGTG 0: 1
1: 0
2: 0
3: 16
4: 109
Right 1033658859 7:143390423-143390445 GATGGGGAGTTGGGTGTGGCTGG 0: 1
1: 1
2: 2
3: 74
4: 604
1033658845_1033658855 5 Left 1033658845 7:143390379-143390401 CCTCTTGCAGGAAGGTCCTAGTG 0: 1
1: 0
2: 0
3: 16
4: 109
Right 1033658855 7:143390407-143390429 CTGGAAGTAGGATAGGGATGGGG 0: 1
1: 0
2: 1
3: 31
4: 305
1033658845_1033658851 -2 Left 1033658845 7:143390379-143390401 CCTCTTGCAGGAAGGTCCTAGTG 0: 1
1: 0
2: 0
3: 16
4: 109
Right 1033658851 7:143390400-143390422 TGGGTGACTGGAAGTAGGATAGG 0: 1
1: 0
2: 0
3: 19
4: 240
1033658845_1033658850 -7 Left 1033658845 7:143390379-143390401 CCTCTTGCAGGAAGGTCCTAGTG 0: 1
1: 0
2: 0
3: 16
4: 109
Right 1033658850 7:143390395-143390417 CCTAGTGGGTGACTGGAAGTAGG 0: 1
1: 0
2: 1
3: 11
4: 133
1033658845_1033658856 11 Left 1033658845 7:143390379-143390401 CCTCTTGCAGGAAGGTCCTAGTG 0: 1
1: 0
2: 0
3: 16
4: 109
Right 1033658856 7:143390413-143390435 GTAGGATAGGGATGGGGAGTTGG 0: 1
1: 0
2: 2
3: 48
4: 544
1033658845_1033658852 -1 Left 1033658845 7:143390379-143390401 CCTCTTGCAGGAAGGTCCTAGTG 0: 1
1: 0
2: 0
3: 16
4: 109
Right 1033658852 7:143390401-143390423 GGGTGACTGGAAGTAGGATAGGG 0: 1
1: 0
2: 0
3: 21
4: 231
1033658845_1033658858 17 Left 1033658845 7:143390379-143390401 CCTCTTGCAGGAAGGTCCTAGTG 0: 1
1: 0
2: 0
3: 16
4: 109
Right 1033658858 7:143390419-143390441 TAGGGATGGGGAGTTGGGTGTGG 0: 1
1: 0
2: 8
3: 88
4: 764
1033658845_1033658857 12 Left 1033658845 7:143390379-143390401 CCTCTTGCAGGAAGGTCCTAGTG 0: 1
1: 0
2: 0
3: 16
4: 109
Right 1033658857 7:143390414-143390436 TAGGATAGGGATGGGGAGTTGGG 0: 1
1: 0
2: 0
3: 28
4: 324
1033658845_1033658853 3 Left 1033658845 7:143390379-143390401 CCTCTTGCAGGAAGGTCCTAGTG 0: 1
1: 0
2: 0
3: 16
4: 109
Right 1033658853 7:143390405-143390427 GACTGGAAGTAGGATAGGGATGG 0: 1
1: 0
2: 3
3: 27
4: 358
1033658845_1033658854 4 Left 1033658845 7:143390379-143390401 CCTCTTGCAGGAAGGTCCTAGTG 0: 1
1: 0
2: 0
3: 16
4: 109
Right 1033658854 7:143390406-143390428 ACTGGAAGTAGGATAGGGATGGG 0: 1
1: 0
2: 2
3: 18
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033658845 Original CRISPR CACTAGGACCTTCCTGCAAG AGG (reversed) Intronic
903353114 1:22730151-22730173 CAGTGGGACCTTCCTCCCAGGGG - Intronic
903369439 1:22825779-22825801 CACCAGGACCCTGCTGCAGGTGG + Intronic
904825784 1:33272912-33272934 CAGAAGGACATTCCTGGAAGAGG - Intronic
907324755 1:53629679-53629701 CAGGATCACCTTCCTGCAAGAGG + Intronic
907627391 1:56043499-56043521 CCATAGGACCCTCCAGCAAGGGG - Intergenic
910959970 1:92751601-92751623 CTCTACTACCTTCCTGAAAGGGG + Intronic
913575919 1:120174828-120174850 CTCTAGGACCATCCTGCAGAAGG - Intronic
914558232 1:148790399-148790421 CTCTAGGACCATCCTGCAGAAGG - Intergenic
914614602 1:149339831-149339853 CTCTAGGACCATCCTGCAGAAGG + Intergenic
922084605 1:222334025-222334047 CACTATGTCCCTCTTGCAAGGGG - Intergenic
923707515 1:236356491-236356513 CCAGAGGACCTTTCTGCAAGGGG + Intronic
1068449859 10:57171950-57171972 CACCAGGACCTACCTGCAGGTGG + Intergenic
1070713475 10:78700511-78700533 GACTTGGCCCTTCCTGAAAGAGG + Intergenic
1077928950 11:6710400-6710422 CACTGGGACCTACCTGAGAGTGG - Intergenic
1080869136 11:36221798-36221820 CACTGGGAGCTTCCAGGAAGGGG - Intronic
1082889359 11:58122056-58122078 CACTGGGACCTGCCAGGAAGAGG + Intronic
1086877903 11:92120191-92120213 CACTAGCACCTTCTGGCAAAAGG + Intergenic
1088988758 11:114932280-114932302 CACTGGGGCCTTCCTGAGAGGGG - Intergenic
1089612642 11:119678010-119678032 CATGATGAACTTCCTGCAAGAGG - Intronic
1089935593 11:122360871-122360893 CTCTAGGAACCTCCTGTAAGTGG + Intergenic
1093758636 12:22880862-22880884 CACTTGCTCCCTCCTGCAAGGGG - Intergenic
1096826975 12:54286943-54286965 CACAAGGACGTTCCTGCAAAAGG - Intronic
1102258994 12:111432004-111432026 CACAAGCTCCTGCCTGCAAGGGG - Intronic
1102931627 12:116866726-116866748 CACTAGGAACTTACGGCAGGTGG + Intronic
1104298030 12:127536377-127536399 CACTAGGACCTACCTGAGGGTGG + Intergenic
1104719536 12:131037564-131037586 CACCAGGATCTTACTGCATGGGG + Intronic
1104719562 12:131037752-131037774 CACCAGGATCTTACTGCATGGGG + Intronic
1105209170 13:18247760-18247782 CAGCAGCACCTTCCTGGAAGAGG + Intergenic
1111412940 13:87900010-87900032 CACTGGGACCTACCTGAAAGTGG + Intergenic
1112856233 13:103773187-103773209 AACTAAGCGCTTCCTGCAAGAGG + Intergenic
1112874966 13:104025974-104025996 CACTGGGTCCTTCCTGCAACAGG - Intergenic
1113931822 13:113972776-113972798 CACCAGGGCCTTCTTGCAAACGG + Intergenic
1118867346 14:69713734-69713756 CTCTAGGGCATTCCAGCAAGAGG + Exonic
1119350474 14:73960650-73960672 GACTATGAACTTCCTGAAAGCGG - Intronic
1126333092 15:47555217-47555239 CATTAGGACATTCTTGAAAGGGG - Intronic
1127360438 15:58240488-58240510 CACTAGCACCTTCCTGGACTTGG + Intronic
1127698575 15:61475122-61475144 CATTAGGACCTTCATGCATGTGG - Intergenic
1128345371 15:66849635-66849657 CACAAGGACCTTCCAGGGAGAGG - Intergenic
1131373047 15:91899494-91899516 CACAAAAAGCTTCCTGCAAGAGG - Intronic
1140199072 16:72879840-72879862 CACAAGAACCTTCCTCCACGTGG + Intronic
1144676651 17:17166432-17166454 CACTAGGACCTTCCTGGCCCAGG - Intronic
1146127037 17:30238113-30238135 CGCTGGGCCCTTCCTCCAAGGGG + Intergenic
1146556109 17:33825476-33825498 CATTAGGACCTTCCTGCTCAGGG - Intronic
1152482025 17:80560658-80560680 CACTGGGGGCCTCCTGCAAGGGG + Intronic
1152640433 17:81447163-81447185 CACAAGGACATTCCTGCCTGGGG + Exonic
1154464203 18:14628504-14628526 CTCCAAGACCTTCCTCCAAGTGG + Intergenic
1155626665 18:27843063-27843085 CACTAGGACTTTTCTGCCACTGG + Intergenic
1157286357 18:46379910-46379932 CACTGGGACGTTGCTGCCAGTGG + Intronic
1157349249 18:46870136-46870158 CACTAGAGCCTTCCTGGAGGAGG - Intronic
1158551472 18:58439690-58439712 CACTAAGTCCTTTCTTCAAGTGG + Intergenic
1165897166 19:39149415-39149437 CTCTAGGTCCTTCGTACAAGTGG - Intronic
1168688483 19:58362700-58362722 CACTAGGAGCGGCCTGAAAGAGG + Exonic
930918902 2:56726860-56726882 CACTAGGACCTACTTGAGAGTGG - Intergenic
932766268 2:74472454-74472476 CCGTAGGACCTTCCTGCAGACGG - Exonic
938752551 2:134347336-134347358 CACTGGGCTCTTCCTGAAAGAGG - Intronic
944659351 2:201907947-201907969 CAATAGTACCTGCCTGTAAGGGG + Intergenic
945520856 2:210825261-210825283 CACTAGGATTATCCTGCTAGGGG - Intergenic
946390680 2:219415015-219415037 CTCTAGGTACTTCATGCAAGTGG - Intergenic
1171290344 20:23979473-23979495 CAGCAGCACCTTCCTGGAAGAGG + Intergenic
1172296403 20:33814198-33814220 CACTAAGACCTTCCTCCTAGAGG - Intronic
1172815988 20:37686680-37686702 CACTGGGACCATCCTGGAAGTGG - Intergenic
1175717721 20:61266561-61266583 TCCTTGGACCTTCCTGGAAGCGG - Intronic
1176132012 20:63500180-63500202 CACTCGGATCTTCCTGCCAGCGG + Intergenic
1176810332 21:13529885-13529907 CTCCAAGACCTTCCTCCAAGCGG - Intergenic
1177774415 21:25551893-25551915 CACCAGGCCCTACCTCCAAGGGG + Intergenic
1180767085 22:18351537-18351559 CAGCAGCACCTTCCTGGAAGAGG - Intergenic
1180779226 22:18510842-18510864 CAGCAGCACCTTCCTGGAAGAGG + Intergenic
1180811945 22:18768162-18768184 CAGCAGCACCTTCCTGGAAGAGG + Intergenic
1181198100 22:21202406-21202428 CAGCAGCACCTTCCTGGAAGAGG + Intergenic
1181401644 22:22653398-22653420 CAGCAGCACCTTCCTGGAAGAGG - Intergenic
1181703602 22:24634495-24634517 CAGCAGCACCTTCCTGGAAGAGG - Intergenic
1182718549 22:32378798-32378820 CACTACCACCTTCCTGCACTGGG - Intronic
1182927835 22:34143090-34143112 CACTGGGGCCTTCCAGCAGGTGG - Intergenic
1183159292 22:36100964-36100986 CACTGGGTCCTTCCCACAAGGGG - Intergenic
1183310164 22:37105284-37105306 AGCTAGGACATTCCTGCATGTGG + Intronic
1185181937 22:49368708-49368730 CATTGGGACCCTCCTGCCAGAGG + Intergenic
1203228707 22_KI270731v1_random:92431-92453 CAGCAGCACCTTCCTGGAAGAGG - Intergenic
951010662 3:17674676-17674698 TTCTAGGACCTTCCTGCACTGGG + Intronic
954001709 3:47562749-47562771 CACTAGGATCATCCTGGAAGAGG + Exonic
957118503 3:76058461-76058483 CACTAGGTGCTTCATGCAAAAGG - Intronic
959301690 3:104610525-104610547 CACTAGGACCTACCTGAGGGTGG + Intergenic
961651598 3:128419536-128419558 CACCAGGAGCTGCCAGCAAGGGG + Intergenic
962119818 3:132549579-132549601 CACATGATCCTTCCTGCAAGGGG + Intergenic
965017895 3:163183000-163183022 CATTAAGTCTTTCCTGCAAGAGG + Intergenic
974444613 4:61963420-61963442 CACTAGGGCCTTCTTGAGAGTGG - Intronic
974552358 4:63395142-63395164 CTCTAGGAACTTCATGTAAGTGG - Intergenic
975393547 4:73848598-73848620 CACTTGGACTTTGTTGCAAGGGG - Intronic
978379729 4:108114429-108114451 AACTAGGCCCTTCCAGAAAGTGG + Intronic
980889528 4:138799588-138799610 TAATAGGACATTCCTGGAAGAGG + Intergenic
981906405 4:149925996-149926018 CACTAGGACCTTTCAGAGAGTGG - Intergenic
983934359 4:173490586-173490608 CATTAGCACTTTCCTGCAATCGG - Intergenic
987072276 5:14349883-14349905 CACTAGGACCTACTTGAAGGTGG - Intronic
989060426 5:37405800-37405822 CTTTAGGAGCTTCATGCAAGAGG + Intronic
989205300 5:38804087-38804109 CAATGGGGCCTTCCTGCATGTGG - Intergenic
991292723 5:65048369-65048391 CACTTGCACCCTCCTGCCAGGGG + Intergenic
992737424 5:79736922-79736944 AACTAAGACTTTCCTGCCAGTGG + Exonic
1003387110 6:5679065-5679087 CTCTAGGAACATCCTGCCAGAGG + Intronic
1006746709 6:36347746-36347768 CACTAGGCCCAACCTGGAAGGGG + Intergenic
1007707733 6:43801299-43801321 CACTAGGGGCTTCCTGGAGGAGG + Intergenic
1012050589 6:94338063-94338085 CACTAAGTCTTTCCTACAAGAGG - Intergenic
1015624444 6:135165814-135165836 CACTGGGACCTACCTGAAGGTGG - Intergenic
1015937804 6:138420282-138420304 CTATAGCACCTTCCTGCAAATGG - Exonic
1022349256 7:29551671-29551693 CAAGAGGCCCTTTCTGCAAGTGG + Intergenic
1022648250 7:32251511-32251533 GACTAGGATCATCCTGGAAGTGG - Intronic
1023169794 7:37379374-37379396 CACTAAGATCTTCCTTGAAGGGG + Intronic
1023682664 7:42703440-42703462 CACCGGGCCCTTCCTGGAAGAGG + Intergenic
1026875403 7:73876523-73876545 CACTGGGACCTTCCAGCCAAAGG - Intergenic
1032203838 7:129844268-129844290 CAATAAGGCCTTCCTGCAAGTGG + Intronic
1033658845 7:143390379-143390401 CACTAGGACCTTCCTGCAAGAGG - Intronic
1034196726 7:149254097-149254119 CACTGGGCCCCTCCTGCAGGTGG - Exonic
1034905002 7:154936210-154936232 CTCTAGGAACCTCATGCAAGTGG + Intronic
1035430695 7:158818553-158818575 CACCAGGACTTGCCTGCAAGCGG + Intronic
1037307976 8:17525761-17525783 AACCAGCACATTCCTGCAAGCGG + Intronic
1040034300 8:42853874-42853896 TACTAAGACTTTCCTGAAAGAGG - Exonic
1040980512 8:53241955-53241977 CACTAGAACGTTCCTTCTAGGGG - Intronic
1043603979 8:81976893-81976915 TACTAGGACCTTCCTTAAACTGG + Intergenic
1048668026 8:136686205-136686227 CACTGGGGCCTACCTGAAAGTGG + Intergenic
1057626911 9:96686172-96686194 CACAAAGAGCTTCCTGCAAGTGG - Intergenic
1061862040 9:133473107-133473129 CACCAAGTCCTTCCTGCCAGTGG - Exonic
1186165479 X:6822220-6822242 CACTAAGGCCTTCATTCAAGAGG + Intergenic
1188878051 X:35456664-35456686 CTCTAGTACCTTCCTTCATGGGG - Intergenic
1189113096 X:38314198-38314220 CAGTAGGACCTTCCTTAAAGGGG + Intronic
1192311536 X:70019728-70019750 CACCAGGGCCTTCTTGCGAGTGG + Intronic
1200291750 X:154882036-154882058 CACTAGGCCCTTCCTTCAACAGG - Intronic
1200338588 X:155377773-155377795 CACTAGGCCCTTCCTTCAACAGG - Intergenic
1200347881 X:155462919-155462941 CACTAGGCCCTTCCTTCAACAGG + Intergenic