ID: 1033658883

View in Genome Browser
Species Human (GRCh38)
Location 7:143390556-143390578
Sequence CCTGGGAAGAAGGAAGGGTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1042
Summary {0: 1, 1: 0, 2: 8, 3: 99, 4: 934}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033658883_1033658896 17 Left 1033658883 7:143390556-143390578 CCTCACCCTTCCTTCTTCCCAGG 0: 1
1: 0
2: 8
3: 99
4: 934
Right 1033658896 7:143390596-143390618 TCGATTGAGGCAGATGACAATGG 0: 1
1: 0
2: 1
3: 3
4: 96
1033658883_1033658892 4 Left 1033658883 7:143390556-143390578 CCTCACCCTTCCTTCTTCCCAGG 0: 1
1: 0
2: 8
3: 99
4: 934
Right 1033658892 7:143390583-143390605 CGGGAAGCCCCTGTCGATTGAGG 0: 1
1: 0
2: 0
3: 5
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033658883 Original CRISPR CCTGGGAAGAAGGAAGGGTG AGG (reversed) Exonic
900758061 1:4451241-4451263 ACTGGGAAGGAGGAAGGGGCTGG - Intergenic
900803255 1:4750801-4750823 TCTGAGAAGAAGGAGGAGTGAGG + Intronic
900895520 1:5480367-5480389 CCTGGGGTGAAGGAAGGCAGGGG + Intergenic
900908454 1:5577206-5577228 CTTGGGGAGAGGGAAGGGTCAGG + Intergenic
900993816 1:6109741-6109763 GCTGGGCAGGAGGAAGGGCGGGG + Intronic
901026516 1:6281286-6281308 CCTGTGGAGAAGGGAGGGCGGGG + Exonic
901157243 1:7149062-7149084 CCTGGGCAGCTGGAAGGGAGTGG - Intronic
901224557 1:7605613-7605635 CCTGGGAAGCACAAAGGGTCAGG - Intronic
901452177 1:9342572-9342594 ACTGGGAACAAGGCAGGATGAGG - Intronic
901457115 1:9369408-9369430 GCTGGTAGGAAAGAAGGGTGGGG - Exonic
901475800 1:9488414-9488436 CCTGAGCAAAAGGAAGGATGGGG + Intergenic
901658245 1:10782785-10782807 CCTGGGAGGGGGGAAGGCTGGGG + Intronic
901730197 1:11273455-11273477 CCCGGGAAGGAGGAAGGACGGGG - Exonic
901850839 1:12014243-12014265 CCTGGGAATCTGGAAGGATGAGG - Intergenic
901972487 1:12919023-12919045 CCTGTGAGGAAGTAAGAGTGAGG + Intronic
902012692 1:13282739-13282761 CCTGTGAGGAAGTAAGAGTGAGG - Intronic
902038832 1:13477545-13477567 GCTGGGAAAAAGGCCGGGTGTGG + Intronic
902921282 1:19667224-19667246 CCTGGGAAGAAGGCAGCCGGGGG - Intronic
903014698 1:20354279-20354301 GCTGGGTGGAGGGAAGGGTGGGG + Intronic
903016613 1:20366047-20366069 CGTTGGAGGAAGGAGGGGTGAGG - Intergenic
903321564 1:22546552-22546574 CCTGGGAAGAAGGGAGGAAAGGG - Intergenic
903755433 1:25657326-25657348 GCTGGGGAGAAGGAAGGGCAAGG + Intronic
904023992 1:27490582-27490604 CCAGGGCAGAAAGTAGGGTGGGG + Intergenic
904131800 1:28281044-28281066 CAGGGGAAGGAGGAAGGGTGTGG - Exonic
904255990 1:29255182-29255204 CCTGGGTAGAAGGGAGAGTGGGG + Intronic
904585117 1:31575974-31575996 CCTGGGAGGTGGGCAGGGTGTGG - Intergenic
904684179 1:32248660-32248682 CCTGGGAAGAGGAAAGGGAGGGG + Exonic
905149836 1:35919033-35919055 CCTGGGAAGATAGGAAGGTGAGG - Exonic
905414496 1:37794770-37794792 TGTGGGAAGGAGGAAGGGTGAGG - Intronic
905452104 1:38063564-38063586 CCTGGGAACCAGGAAGGATTGGG + Intergenic
905482642 1:38271925-38271947 CCTGGGAAGGAGGAAGACTTTGG - Intergenic
906074637 1:43042979-43043001 CCTGTGAAAGAGGAAGGGGGAGG - Intergenic
906108771 1:43309775-43309797 GCTGGGCAGGAGGAAGGGCGGGG - Intronic
906553316 1:46685227-46685249 CCTGGGAATGAGGCAGGGTATGG - Intronic
906608982 1:47189328-47189350 CCTGGGAGGTGGGCAGGGTGGGG + Intronic
907317508 1:53581858-53581880 CCTAGGGAGGAGGAAGGGGGTGG - Intronic
907634286 1:56117997-56118019 CCTGGGATGAGGGAAGGGATTGG + Intergenic
907663353 1:56413756-56413778 GCTGGGTTGAAGGAAGGCTGTGG - Intergenic
907728148 1:57039617-57039639 AGTGGGAAGGAGAAAGGGTGGGG - Intronic
908570504 1:65405492-65405514 GCTCAGAAGATGGAAGGGTGGGG + Intronic
908809020 1:67960110-67960132 CGTAGGAAGAAGGATGGCTGAGG - Intergenic
909391870 1:75129292-75129314 GCAGGGAAGGAGGAAGGGAGAGG + Intronic
909427943 1:75549421-75549443 ACTAAGAAGAAGGAAGAGTGGGG - Intronic
911054997 1:93701673-93701695 CCTGGGAAGCAGGCAGAGTGGGG - Intronic
911089516 1:94007375-94007397 CCTGGGAAGCACTAAGTGTGTGG - Intronic
912296720 1:108476871-108476893 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
912386143 1:109272202-109272224 GCTGGGAAGAAGGAGGGTGGAGG - Intronic
912617350 1:111116916-111116938 CCTGGCCAGAAGAAAAGGTGGGG - Intergenic
912796500 1:112696608-112696630 CCTGGGAAGCAGAAGAGGTGTGG - Exonic
913089413 1:115466358-115466380 CCAGGGAGGAAGGAGGGCTGTGG - Intergenic
915596975 1:156901548-156901570 CCAGGGCAGAAGGATGGCTGGGG + Intronic
916077279 1:161209171-161209193 CCTGGGAAGAGGGAGGAATGTGG - Exonic
916146001 1:161739925-161739947 CCGGGGAAGAATGGAGGGAGAGG + Intergenic
916490764 1:165300403-165300425 AATGGGAAGAAGGATGGGTTAGG - Intronic
916505151 1:165422111-165422133 TCGGAGGAGAAGGAAGGGTGAGG - Intronic
916999205 1:170337744-170337766 TCTGGTAAGAGGGAAGGCTGAGG - Intergenic
917231983 1:172847156-172847178 TCTGTGAAGAAGGAAAGGAGAGG + Intergenic
917525672 1:175786299-175786321 CATGGGAAGAAGAGAGGCTGAGG - Intergenic
917962047 1:180153388-180153410 CAAGAGAAGAAGGAAGGCTGAGG + Intergenic
919654029 1:200180331-200180353 TGTGGGAAGAAGGAGAGGTGAGG - Intergenic
919791709 1:201295184-201295206 CCTGGGGAGAGGAGAGGGTGAGG + Intronic
919915352 1:202135526-202135548 CCTACGGAGAAGGGAGGGTGAGG + Exonic
920229619 1:204461758-204461780 CCTGGGAGGAAGGAAGAGTGTGG + Intronic
920230377 1:204466137-204466159 CCTAGGGAGAAGGAAGTGAGGGG + Intronic
920288900 1:204902612-204902634 GGTGGGGAGAAGGAAAGGTGGGG + Intronic
920646704 1:207809066-207809088 GCTGGGAAGAAGGTAGGAGGTGG - Intergenic
921149770 1:212390653-212390675 CCCGGGAAGCAGAAAGGGTCAGG + Intronic
921294364 1:213688232-213688254 CTTGGGGAGAAGGAAGTGGGAGG - Intergenic
921308822 1:213823017-213823039 CCTGGGAAATAGGCAGGGTAAGG - Intergenic
922048662 1:221969871-221969893 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
922567164 1:226608234-226608256 CCAGGGAGGAAAGAAGGGAGAGG + Exonic
922738123 1:228000648-228000670 CCTGGAAAGAAAGCAGTGTGGGG + Intergenic
922816309 1:228452312-228452334 CATGGGAAAAAGGAAGTGTCAGG + Intergenic
922932795 1:229403365-229403387 CTTGAGCAGAAGGAAGAGTGAGG + Intergenic
923057623 1:230439093-230439115 CCTGGGAAGTAATAGGGGTGTGG - Intergenic
923075480 1:230605316-230605338 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
923134639 1:231107314-231107336 CCTGGGATGAAGGCAGAGTGTGG - Intergenic
923743454 1:236677718-236677740 CCATGGAAGAAGGAAGGCAGCGG + Intergenic
923770492 1:236934043-236934065 ACAGGGAAGAAGGAAATGTGGGG + Intergenic
924180951 1:241438115-241438137 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
924933488 1:248748484-248748506 CCTGGTAAGGAGGAGGTGTGGGG + Intronic
1063216831 10:3932544-3932566 CATGGGCAGAGGGGAGGGTGGGG + Intergenic
1063312610 10:4968800-4968822 CCTGGGAAAAAGGAATTGTGAGG - Exonic
1063315325 10:4998747-4998769 CCTGGGAAAAAGGAATTGTGAGG + Exonic
1063855844 10:10252707-10252729 CCTGAGAAGCAGTAAGGATGGGG - Intergenic
1063983302 10:11473915-11473937 CCTGAGGAGAAGGAAGAATGAGG + Intronic
1064163580 10:12966909-12966931 CCTGGGAGGAAGGCAGGGTGTGG + Intronic
1064262718 10:13798939-13798961 CTGGGGAAGAAGGAAGGGAAAGG - Intronic
1064288501 10:14013019-14013041 CCAGGGCAGAAGGCAGGCTGAGG + Intronic
1065950817 10:30649129-30649151 GCTGGGCAGAAGGAAAGTTGGGG - Intergenic
1067226802 10:44382102-44382124 CCTGGGGACAAGGAAGTGGGGGG - Intronic
1067726739 10:48776310-48776332 CCAGTGGAGAAGCAAGGGTGCGG + Intronic
1067751374 10:48973945-48973967 ACTGGGAAGAAGAAAAGGGGAGG - Intronic
1067847713 10:49736838-49736860 GCTGGGCAGAAGCAAGGTTGGGG - Intronic
1068819189 10:61353253-61353275 CTTGGCAAGAAAGAAGGTTGAGG - Intergenic
1068827971 10:61461011-61461033 GCAGGGAGGAAGGAAGGGTGAGG + Intergenic
1069728255 10:70594995-70595017 CCTAGGTATAAGGGAGGGTGCGG + Intergenic
1069903771 10:71720458-71720480 TCTGGGGAGAAAGAAGGCTGGGG - Intronic
1069913659 10:71774414-71774436 GCCGGGAAAAAGGAAGGGTCAGG - Intronic
1070566294 10:77606031-77606053 GCTGGGAAGATGGTAGTGTGTGG - Intronic
1070641005 10:78169856-78169878 CCTGCAAAGGAGGATGGGTGAGG - Intergenic
1070665763 10:78342323-78342345 CCTGGGAGGGAGGGAGGGTTAGG + Intergenic
1070680932 10:78448531-78448553 CCTGTGAAGGATAAAGGGTGGGG + Intergenic
1070991080 10:80732686-80732708 CCTGGGAACAGGGAATGCTGGGG + Intergenic
1071797435 10:89021553-89021575 CCAGGGAAGGAGCAAGGGTCAGG - Intergenic
1071854593 10:89610799-89610821 ACATGGAAGAAGGAAGGGTTGGG - Intronic
1072430769 10:95368951-95368973 CGTGGGAGGAAGGAAGGGAGGGG - Intronic
1072439275 10:95439403-95439425 CCAGAGAAGGAGGAAGGGAGGGG - Intronic
1072539565 10:96388028-96388050 CCTAGGAAGAAGAAAGGATATGG + Intronic
1073054572 10:100690857-100690879 GATGTGAAGGAGGAAGGGTGGGG + Intergenic
1073248810 10:102109282-102109304 CCCGGGAACAAGGAAGGGGTGGG + Intronic
1073453735 10:103624188-103624210 CCTGGGAAGAAGGGGATGTGGGG + Intronic
1073543926 10:104333621-104333643 CCAGAGAGGAAGGAAGGGTAAGG - Exonic
1073580417 10:104660536-104660558 GCTGGGTAGAGGGGAGGGTGAGG - Intronic
1074123096 10:110507869-110507891 CCTAGGAAGATGGATGGGGGAGG - Intronic
1074160084 10:110829844-110829866 CCTGGGTAGAAGGAAGGAAGGGG - Intronic
1074554763 10:114478020-114478042 CCAGTCAAGAAGGAAGGGAGAGG - Intronic
1074724131 10:116289926-116289948 ACAGGGAAGCAGGAAGGGAGAGG - Intergenic
1074948512 10:118304593-118304615 CCTAGGTAGAAGGAACGGCGTGG - Exonic
1074983022 10:118634798-118634820 CTTGGGAAGGATGAAGGGTCTGG - Intergenic
1075007104 10:118839106-118839128 CCTGGGGAGGAGGAAGGGATGGG + Intergenic
1075257842 10:120939499-120939521 TCAGGGAAGGAGGAAGGGAGGGG - Intergenic
1075616136 10:123891889-123891911 GGAGGGAAGAAGGAAGGGCGGGG - Intronic
1075669722 10:124256138-124256160 CTTGGGAAGAATGAGGGGAGAGG + Intergenic
1075709345 10:124522355-124522377 CCTGGGCAGCAGGAACGCTGTGG - Intronic
1075710941 10:124530221-124530243 GCTGGGACGCAGGAGGGGTGGGG - Intronic
1075726031 10:124611393-124611415 CCTTGGAGGATGGAAGGGAGAGG + Intronic
1076819201 10:132930409-132930431 TGTGGGAAGAAGGAAGGCTCAGG - Intronic
1076842222 10:133051237-133051259 CCTGGAAACAGGGATGGGTGGGG + Intergenic
1076891956 10:133289207-133289229 ACCGGGAAGGAGCAAGGGTGTGG - Intronic
1077081340 11:725968-725990 CCTGGGCAGAAGGAAAGGGCTGG + Intronic
1077160324 11:1109704-1109726 CCTGGGGGGTAGGCAGGGTGGGG + Intergenic
1077172784 11:1175430-1175452 AGGGGGAAGAAGGGAGGGTGTGG + Intronic
1077269593 11:1669234-1669256 CACGGGAAGAGGGATGGGTGAGG + Intergenic
1077279218 11:1734555-1734577 CCTGGGGGGACGGAAGGGGGTGG - Exonic
1077588493 11:3473064-3473086 ACAGGGAAGAAGGAAATGTGGGG + Intergenic
1078318100 11:10308289-10308311 CTTGGGAAGGAGGAAGGAAGAGG - Intergenic
1078582434 11:12548919-12548941 CCTGGGAAGCATGCAGGATGTGG - Intergenic
1079353842 11:19714215-19714237 CCTGGGGAGGAGGAAAGGTCGGG + Intronic
1079785944 11:24673096-24673118 CCATGGATGGAGGAAGGGTGGGG - Intronic
1080117994 11:28641880-28641902 CCTGGGAAAAGGGGAGGCTGTGG + Intergenic
1080178541 11:29395095-29395117 CATGGAAAGAAGGAAGGGAGGGG + Intergenic
1080749531 11:35139388-35139410 CCTGGGCAGCAAGATGGGTGCGG + Intronic
1081338155 11:41893656-41893678 CCTTGGGACAAGGAAGAGTGTGG - Intergenic
1081576767 11:44323613-44323635 CCAGGTCAGAAGGAAAGGTGAGG + Intergenic
1081652784 11:44835493-44835515 CCAGGGAAGGAGGAAGGCTTGGG + Intronic
1081780013 11:45703736-45703758 CTTGAGAACAAGGAAGTGTGTGG + Intergenic
1081789624 11:45773768-45773790 CCTAGGAAGGAGGAAAAGTGGGG + Intergenic
1082586422 11:54947161-54947183 CCTGGGAAGCACAAAGGGTCAGG + Intergenic
1082854345 11:57793109-57793131 TTCAGGAAGAAGGAAGGGTGTGG - Intronic
1083274437 11:61588641-61588663 CCTGGAAAGGAGGAAGAATGAGG + Intergenic
1083277194 11:61603572-61603594 CCTGGGAAGAGGAGTGGGTGGGG - Intergenic
1083439705 11:62667747-62667769 CCTGGGATGGAGGAAGAGAGGGG + Exonic
1083597133 11:63923331-63923353 CATGGGATGAAGGGAGGGTTGGG - Intergenic
1083625606 11:64070572-64070594 CCGGGGGAGAGGGGAGGGTGAGG - Intronic
1083630823 11:64094469-64094491 GCTGGGGACAAGGAAGGGTCAGG + Intronic
1083793119 11:64998835-64998857 CCTGGAAACCAGGAAGGCTGGGG + Intergenic
1083906237 11:65673216-65673238 CCTCTGAAGACTGAAGGGTGAGG - Intergenic
1084244196 11:67844693-67844715 ACTGGGAAGAAGGAAATGTGGGG + Intergenic
1084279519 11:68078336-68078358 CCAGGGCAGAAGGCAAGGTGAGG + Intronic
1084490663 11:69476563-69476585 GCTGGGGAGAGGGAAGGGGGAGG - Intergenic
1084519632 11:69655483-69655505 CCTGGGAGGAAGGTGGGGTGTGG + Intronic
1084613019 11:70216012-70216034 ACAGGGAAGAAGGAAATGTGGGG + Intergenic
1084665041 11:70571770-70571792 CCTGAGGAGAGGGAGGGGTGCGG + Intronic
1084666524 11:70579411-70579433 TCTGGGCAGAAGGAAGGGAAGGG - Intronic
1084709043 11:70832716-70832738 CCTGGGCAGAAGAGGGGGTGGGG - Intronic
1084728908 11:71060563-71060585 CCTGGGGAGCAGGAAGGCAGAGG + Intronic
1084828494 11:71749870-71749892 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
1084900597 11:72307254-72307276 CCTAGTAAGAAAGAAGGGGGAGG + Exonic
1084951316 11:72667446-72667468 ACTGGGAGGAATGAAGGCTGAGG - Intronic
1085003300 11:73061192-73061214 CCTGGGAAGCACAAAGGGTCAGG + Intronic
1085173986 11:74470900-74470922 CCTGGGAAGATGGGGGAGTGGGG + Intergenic
1085236316 11:75018250-75018272 AGTGGGAAGAAGGCAGGGAGGGG - Intronic
1085400788 11:76234360-76234382 CCTGGGAATAAGGAAACGTGAGG + Intergenic
1085771944 11:79333415-79333437 GCTGGGAAAGAGGAATGGTGTGG - Intronic
1086392852 11:86383192-86383214 CCATGGAAGCAGGAAGGCTGTGG + Intronic
1086404728 11:86489813-86489835 CCTGTGAAGAATAAAGGGGGAGG - Intronic
1087099918 11:94353773-94353795 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
1087197169 11:95313444-95313466 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
1087268303 11:96084578-96084600 CCTTGAAAGGTGGAAGGGTGGGG - Intronic
1087954194 11:104264651-104264673 GCAGGGAAGAAGGAAGAGTGTGG - Intergenic
1088039824 11:105366245-105366267 CCTTGGAAGGAGGAAAGATGGGG - Intergenic
1089053329 11:115564841-115564863 TCAGGGATGAAGGAAGGGAGGGG - Intergenic
1089118865 11:116117865-116117887 ACAGGGAAGGAGGAGGGGTGAGG + Intergenic
1089147419 11:116339899-116339921 CCTGGGCAGGAGGAAGGCTGTGG - Intergenic
1089256464 11:117196849-117196871 CCTGGAAAGAAGGAAGGGAAGGG - Exonic
1089866791 11:121639702-121639724 ACAGGGAAGAAGGAAATGTGGGG + Intergenic
1089953622 11:122551261-122551283 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
1090617228 11:128526146-128526168 GGAGGGAAGAAGGGAGGGTGGGG + Intronic
1090763237 11:129855228-129855250 CCTGGGCAAAAGGTAGAGTGTGG - Intronic
1090926679 11:131256273-131256295 ACAGGGAAGAAGGAAATGTGGGG + Intergenic
1090952127 11:131482899-131482921 CCTGGGAAAAAGGAAGCTTCAGG + Intronic
1091098057 11:132842395-132842417 GCTGGGAAGAGGGGAGGCTGTGG - Intronic
1091238394 11:134036750-134036772 CCTGGGAAAGAGGAAGGGAAAGG + Intergenic
1091278776 11:134370308-134370330 CTTGGGAAGAAGGTCAGGTGGGG - Exonic
1091307065 11:134543050-134543072 CCTGGGAAGGAGGCAGAGAGGGG - Intergenic
1091456493 12:612046-612068 CCTGGGAAAAAGGGAGGGAGGGG - Intronic
1091618417 12:2067257-2067279 CCTGGGATGGAGGCAGGCTGGGG - Intronic
1091700432 12:2655329-2655351 CCCGGGGAGTAGGAAGGGAGAGG + Intronic
1092345699 12:7712937-7712959 ACTGGGAAAATGGAAGGGAGAGG + Intronic
1092474740 12:8808853-8808875 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
1092614328 12:10202668-10202690 TCTAGGAAGAAGGCAGGGTGCGG + Intergenic
1092924535 12:13261368-13261390 ACAGGGAAGAAGGAAATGTGGGG + Intergenic
1093074073 12:14739287-14739309 CCAGGGTGGAAGGAATGGTGGGG - Intergenic
1093131367 12:15395299-15395321 CCTTGGAAAGAGGAAGGGTGAGG + Intronic
1093141625 12:15516548-15516570 GGAGGGAAGAAGGAAGGGGGAGG + Intronic
1093358742 12:18199257-18199279 ACAGGGAAGAAGGAAATGTGGGG - Intronic
1093579071 12:20767298-20767320 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
1093785290 12:23185452-23185474 CCTGGGGAGAAAGAAGGGGAAGG - Intergenic
1095616717 12:44198843-44198865 AAAGGGAAGAAGGAGGGGTGAGG + Intronic
1095913974 12:47457728-47457750 CCTGGGAAGCATGAGGGGTAGGG - Intergenic
1096130322 12:49153938-49153960 CCTGGCAACATGGAAGGCTGAGG - Intergenic
1096610842 12:52800458-52800480 CCTGGGGAGGAGGAATGGTAAGG + Intergenic
1096647022 12:53044441-53044463 GCTGGGAACCAGGAAGAGTGGGG - Intergenic
1096792622 12:54054387-54054409 CTAGGGAAGAAGGGAGGGAGGGG - Intronic
1096969812 12:55656649-55656671 CCTGTGCAGAATGAAGGGTTTGG - Intergenic
1096976784 12:55703864-55703886 CATGGGGAGAAGGAAGGATGGGG - Intronic
1097280807 12:57844901-57844923 GCTGGGAGGGGGGAAGGGTGGGG - Intronic
1097293585 12:57941161-57941183 CCCCGGAAGAAGGCAGGGAGTGG + Intergenic
1097321770 12:58233546-58233568 GCAGGGAAGTATGAAGGGTGGGG + Intergenic
1097440179 12:59598302-59598324 ATTGGGAAGAATGAAGTGTGTGG + Intronic
1097683944 12:62674862-62674884 CCTGGGGAGTGGGGAGGGTGAGG + Intronic
1098926178 12:76351199-76351221 AATGGGAAGAAAGGAGGGTGGGG + Intergenic
1099055307 12:77833101-77833123 ATTGGGAAGGAGGAATGGTGGGG - Intronic
1099291844 12:80784861-80784883 ACAGGGAAGAAGGAAATGTGGGG + Intergenic
1099806864 12:87531163-87531185 CCTGGGAAGCACAAGGGGTGAGG + Intergenic
1100542998 12:95575660-95575682 CCTGGGGAGAGAGAAGGGGGAGG + Intergenic
1101734304 12:107451665-107451687 ACTGGGGGGAAGGAAAGGTGGGG - Intronic
1101926817 12:108978663-108978685 TCTGGGAAGGAGAAAGGGAGAGG + Exonic
1101996656 12:109530362-109530384 CCTGGGAAGCTAAAAGGGTGGGG - Intronic
1103084141 12:118048944-118048966 CCCGGGTAGAAGGAAGGGCCTGG - Intronic
1103154708 12:118674538-118674560 CCTGGGAAGCATGAGGGGTTGGG - Intergenic
1103394276 12:120596053-120596075 CCTGGGGAGAAGCAAGAATGAGG + Intergenic
1103480115 12:121245309-121245331 GCTGGGGAGAAGGAAGAGGGAGG - Intronic
1103523061 12:121549109-121549131 CATGGGAGGAAGGAAGGGCAGGG + Intronic
1103526847 12:121574865-121574887 CCAGGGAAGCTGGAAGTGTGGGG + Intronic
1103566363 12:121817776-121817798 CTGGGGGAGAAGGAAGAGTGGGG - Intronic
1103648917 12:122417889-122417911 CCTAGGGAGAAGGAAGGAGGAGG - Intronic
1103841599 12:123869700-123869722 CCTGAGAAGGAGGAAGGGGCTGG - Intronic
1104494083 12:129220326-129220348 CGTGGGGAAAAGGAAGTGTGTGG - Intronic
1104718450 12:131031571-131031593 CCAGGCCTGAAGGAAGGGTGGGG - Intronic
1105418177 13:20231382-20231404 CCTGGGGAGCAGGAAGGGTCAGG - Exonic
1105782693 13:23718033-23718055 TCTGGGAAGAAGGAAGGGAAGGG - Intergenic
1105811743 13:24001656-24001678 GGTGGGAAGCAGGAGGGGTGAGG + Intronic
1105907245 13:24824078-24824100 TCTGGGAAGAGGGTAGGGTGAGG + Intronic
1106301349 13:28469066-28469088 CCTGGGAAGAGGGGAGGAGGAGG - Intronic
1106370750 13:29130368-29130390 CCTGGGCAGAAGGAAGAGCGAGG - Intronic
1106539599 13:30678170-30678192 TCTGGGAAGTAGCAGGGGTGGGG + Intergenic
1106550569 13:30767448-30767470 CCTGGGAAGAAAGGAGGCTGTGG + Intergenic
1106646337 13:31638355-31638377 CCTGGGAAGCACAAAGGGTCAGG - Intergenic
1106872108 13:34032917-34032939 CACGGGAGGAAGGAAGGGTTAGG - Intergenic
1107097531 13:36552645-36552667 CCTGAGAAGAAGGATGGGAAAGG + Intergenic
1107220012 13:37970752-37970774 ACAGGGAAGAAGGAAATGTGGGG + Intergenic
1107335366 13:39348805-39348827 CCTAGGAAGAGGGTAGTGTGGGG - Intronic
1107449423 13:40495227-40495249 AATATGAAGAAGGAAGGGTGGGG - Intergenic
1107548994 13:41457845-41457867 CCGGGGAGGATGGAAGGGTGGGG - Intronic
1107625144 13:42274202-42274224 CCTGGAAGGATTGAAGGGTGAGG + Intronic
1107859148 13:44644191-44644213 CCTGTGAGGAAGGAAAAGTGGGG + Intergenic
1108149312 13:47515579-47515601 CCTGGGTAGAAGGTAGGGTGTGG - Intergenic
1108357672 13:49642143-49642165 ACTGAGGGGAAGGAAGGGTGTGG - Intergenic
1109342859 13:61084091-61084113 CCAGAGTAGAAGGAAGAGTGGGG + Intergenic
1109343881 13:61092670-61092692 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
1109978709 13:69876376-69876398 CAATGCAAGAAGGAAGGGTGAGG - Intronic
1110775721 13:79406030-79406052 CTGGGGAAGAGGGAAGGGGGAGG - Exonic
1110845594 13:80187613-80187635 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
1112012759 13:95305814-95305836 CCTGTGAAGAAGGAAGAGTGGGG - Intergenic
1113571878 13:111363687-111363709 CCTGGGCTGGAGGCAGGGTGTGG - Intergenic
1113575653 13:111393560-111393582 CCTGGGGAGAAGGAATGGCTGGG + Intergenic
1113847265 13:113399477-113399499 CCTGGGCAGGAGGGAGGGTCTGG - Intergenic
1114529662 14:23387968-23387990 ACTGGGAAGCAGGAGGGCTGGGG - Intronic
1115203231 14:30875034-30875056 CCTGCGAAGAGAGAAGCGTGAGG - Exonic
1116577642 14:46595348-46595370 TCAGGGAAGAAGGAGGGATGGGG - Intergenic
1116702111 14:48256948-48256970 ACAGGGAAGAAGGAAATGTGGGG + Intergenic
1116790500 14:49335138-49335160 GCTGGGAAGCAGGAATTGTGAGG - Intergenic
1116921223 14:50577658-50577680 GCTGGGGAGTAGGAAGGGTATGG - Intronic
1117231702 14:53725568-53725590 CCTGGGAGGATGGAGGAGTGTGG - Intergenic
1117328937 14:54693844-54693866 CCTGGGAATAAGGGAGTGTAAGG + Intronic
1117860634 14:60089252-60089274 TCTGGGAACAAGGCAGAGTGAGG + Intergenic
1118837664 14:69488031-69488053 CCTGGGGAGGAGAAGGGGTGAGG - Intronic
1119236764 14:73026661-73026683 TCCGGGTGGAAGGAAGGGTGAGG - Intronic
1119265304 14:73260647-73260669 CCTGGGATGCAGGGAGCGTGGGG + Intronic
1119325070 14:73755045-73755067 CCTGGGAAGGAAGGAGAGTGGGG - Intronic
1120054251 14:79903997-79904019 TCTGGGAAGATGGAAGAGTAGGG - Intergenic
1120363876 14:83541277-83541299 CCTGGCGAGAAGGGAGGATGGGG - Intergenic
1120826711 14:88962690-88962712 GCTGGGAAGACGGAAGGGGCTGG + Intergenic
1120963017 14:90142107-90142129 CCTGGGGACAGGGAAGGGAGGGG - Intronic
1121005286 14:90486803-90486825 CATGGGAAGATGGTAGGGAGAGG + Intergenic
1121020986 14:90580021-90580043 CCAGGGAAGAAGGAGGGCTTCGG - Intronic
1121156738 14:91692279-91692301 CCTGGGCAGAAGGAACAGAGTGG - Intronic
1121288147 14:92752545-92752567 CCTGGGTGGCAGGAAGGGGGAGG + Intergenic
1121494966 14:94385803-94385825 CCAGGAAAGATGGATGGGTGTGG - Intronic
1121728517 14:96170343-96170365 CTTGGGAAGGAGGAGGGATGGGG + Intergenic
1122220787 14:100238407-100238429 CCTGAGGAGAAGGGAGGGAGGGG - Intronic
1122687980 14:103518978-103519000 CCTGGGCAGAAGGGGGGTTGGGG - Intergenic
1122832054 14:104403182-104403204 CCAGAGAAGGAGGAAGGGTGGGG - Intergenic
1202856883 14_GL000225v1_random:57639-57661 CCTGGGAGGGTGGAGGGGTGTGG - Intergenic
1124068110 15:26365010-26365032 CCTGGGAATATGGAGGGGTTTGG - Intergenic
1124120655 15:26885723-26885745 CCATGGAAAAAGGAAGGGTTTGG + Intronic
1124623705 15:31295939-31295961 CCTAGGGGGAAGGAGGGGTGGGG - Intergenic
1124789888 15:32717844-32717866 GCGGGGAAGCAGGAGGGGTGCGG + Intergenic
1124818043 15:33016754-33016776 CCGGGGAAGAAGGAGGGGTGAGG - Intronic
1125041507 15:35192553-35192575 CCTGTGAAGCAAGAAGGATGTGG - Intergenic
1125795461 15:42401291-42401313 CTAGGGAGGCAGGAAGGGTGAGG + Intronic
1126268290 15:46780955-46780977 CAAGGGAAGAAGAAAGGGAGGGG - Intergenic
1126330212 15:47523403-47523425 GCTGGGAAGGAGACAGGGTGGGG + Intronic
1126721253 15:51582892-51582914 CCTGGGAATGAGGAGGGGAGGGG - Intronic
1126799629 15:52287330-52287352 CGTGGCAACAAGGATGGGTGTGG - Intronic
1126844056 15:52742886-52742908 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
1126965426 15:54047409-54047431 GGTGGGGAGAAGGAAGGGTAGGG - Intronic
1127264173 15:57347893-57347915 CCTGGGAAGAGGGGAGGTTAAGG + Intergenic
1127774123 15:62252392-62252414 CTTGGGAGGAAGGGATGGTGGGG - Intergenic
1128538093 15:68505566-68505588 CCTTGAAAGAAGGAAGGATTTGG + Intergenic
1128741478 15:70086861-70086883 AAGGGGAAGAAGGCAGGGTGGGG - Intronic
1129172772 15:73818025-73818047 CCTGAGCAGAAGGAAAGATGAGG + Intergenic
1129538007 15:76329948-76329970 CCTAGGAAGAGGGAACGGTCTGG - Intergenic
1129711225 15:77821066-77821088 CCTGGGTGGGAGTAAGGGTGGGG - Intergenic
1130773021 15:86944074-86944096 CAGGTGAAGAATGAAGGGTGGGG + Intronic
1131058787 15:89391831-89391853 CCTGGGAGGTAGGAATGGGGAGG - Intergenic
1131259146 15:90879649-90879671 ACTGCAAAGAAGGAAGGGAGAGG - Exonic
1131739220 15:95369309-95369331 CATGGGAAAAAGGGAGGGGGTGG + Intergenic
1132044034 15:98548901-98548923 CTTGGGAAGGCAGAAGGGTGGGG - Intergenic
1132263303 15:100444435-100444457 GCAGGGAAGAAGGAAATGTGGGG - Intronic
1132340678 15:101076475-101076497 GCAGGGAAGAAGGAAATGTGGGG - Intronic
1133598314 16:7314103-7314125 CTTGGGGAGGAGGAAGGGAGAGG + Intronic
1133869293 16:9672865-9672887 ACAGGGAAGAAGGAAATGTGGGG + Intronic
1133963758 16:10516695-10516717 CCAGGGCAGGAGCAAGGGTGGGG - Intergenic
1133989299 16:10692270-10692292 CCTGGGAAGAATGATGGGCAGGG - Intronic
1135001596 16:18781202-18781224 CAGGGGAAGAAGGAGTGGTGTGG - Intergenic
1135707640 16:24688452-24688474 CCAGGGAAGCAGGAAAAGTGTGG + Intergenic
1135763633 16:25157838-25157860 ACTGGGAAGCAAGAAAGGTGGGG - Intronic
1136155660 16:28380379-28380401 GCTGGGAAGAAAGAAGGCAGAGG + Exonic
1136185444 16:28585797-28585819 CATGGGAGGAAGGCAGGCTGGGG - Intronic
1136207424 16:28734910-28734932 GCTGGGAAGAAAGAAGGCAGAGG - Exonic
1136276310 16:29181174-29181196 CCTGGGAAGCTGGAAAGATGGGG + Intergenic
1136404495 16:30036214-30036236 ACTTGGAAAAAGGAAGGGAGGGG + Intronic
1136411866 16:30082462-30082484 CCTGGGGAACAGGAAGAGTGGGG - Exonic
1136412819 16:30086695-30086717 TCTGGGGAGAGGGAAGGGAGAGG + Exonic
1136539822 16:30923197-30923219 CCTGGGAAGGAGGTCGGGTCGGG + Intronic
1136627776 16:31472386-31472408 CGAGGGAAGAAGGGAGGGAGCGG - Intronic
1136712972 16:32254618-32254640 CCTGGGAAGCAGCCTGGGTGGGG - Intronic
1136754944 16:32674820-32674842 CCTGGGAAGCAGCCTGGGTGGGG + Intronic
1136813169 16:33195549-33195571 CCTGGGAAGCAGCCTGGGTGGGG - Intronic
1136819645 16:33305629-33305651 CCTGGGAAGCAGCCTGGGTGGGG - Exonic
1136826208 16:33362164-33362186 CCTGGGAAGCAGCCTGGGTGGGG - Intronic
1136831274 16:33460935-33460957 CCTGGGAAGCAGCCTGGGTGGGG - Exonic
1137264220 16:46855478-46855500 TCTGGGAAGAAGGGAGAGGGAGG - Intergenic
1137395754 16:48115245-48115267 CCTGGGAGCCAGGAAGGCTGGGG + Intronic
1137454300 16:48606419-48606441 CCTGGGAAAGATGAAGGCTGAGG - Intronic
1137585305 16:49660699-49660721 CCAGGGAAGCAGCAAGGGTGTGG + Intronic
1137640258 16:50022820-50022842 AATGGGAAGGAGGAAGGTTGAGG + Intergenic
1137742883 16:50798066-50798088 CTTGGGTAAAATGAAGGGTGTGG + Exonic
1138444249 16:57053492-57053514 CCTGGGAACATGAAAGGGAGAGG + Intronic
1138454650 16:57114312-57114334 CCTGGAAGGAAGGCAGGGTGAGG + Intronic
1139219981 16:65171438-65171460 ACTGGGAAGAAGGATTGGAGAGG + Intergenic
1139253464 16:65519021-65519043 GCTGGCAAGGAAGAAGGGTGTGG + Intergenic
1140768717 16:78183735-78183757 GATGGGAAGAAGGAAAGGTGGGG - Intronic
1141142201 16:81503863-81503885 CCTGGGAACAGGGCAGGATGTGG + Intronic
1141194274 16:81848273-81848295 CTTGGGAAGAAGCAAGAGAGGGG + Intronic
1141288410 16:82694548-82694570 CCTGGGAGGAAGGGAAGGAGGGG - Intronic
1141638883 16:85329808-85329830 CCTGGGAAGAAGGCTGGGGACGG + Intergenic
1141997240 16:87643376-87643398 CCCCAGAAGAAGGGAGGGTGGGG - Intronic
1142080692 16:88147233-88147255 CCTGGGAAGCTGGAAAGGTGGGG + Intergenic
1142174471 16:88638897-88638919 GCTGGGAACAAGGAAAGCTGAGG + Intronic
1142399333 16:89851119-89851141 TCTGGTAAGAAGAAAGTGTGAGG - Intronic
1202991745 16_KI270728v1_random:18519-18541 CCTGGGAAGCAGCCTGGGTGGGG - Intergenic
1203057085 16_KI270728v1_random:935150-935172 CCTGGGAAGCAGCCTGGGTGGGG + Intergenic
1142700671 17:1658425-1658447 GCTGGGAAGAAGGCAGGATGGGG - Intronic
1143153914 17:4823622-4823644 CCTGGGTAGAAGGACGGGCAGGG + Intergenic
1143299130 17:5896496-5896518 CCTGGGAGGAAGCATGGCTGGGG + Intronic
1143519068 17:7435485-7435507 TATGGGAAGCAGTAAGGGTGGGG - Exonic
1143529085 17:7490784-7490806 TTTGGGTAGAAGGATGGGTGAGG + Intronic
1143818697 17:9541928-9541950 CCTGGGCAGCAGTAAGGCTGGGG - Intronic
1144087311 17:11822416-11822438 CCTGAGAAGTCAGAAGGGTGGGG - Exonic
1144221187 17:13101351-13101373 CCAGGGCAGGAGGAAGGTTGGGG - Intergenic
1144707861 17:17381176-17381198 GCTGGGAATAGGGAAGGGAGGGG - Intergenic
1144932901 17:18874592-18874614 GCTCTGAAGGAGGAAGGGTGTGG + Intronic
1145001077 17:19304990-19305012 CCTGTGGAGAAGGCAGGGTGAGG - Intronic
1145816366 17:27797794-27797816 CCTGGGAGGAAGGATGGGCCCGG + Intronic
1145941561 17:28745616-28745638 CCAGGGAAGAAGACAGGATGGGG - Intronic
1146022884 17:29293759-29293781 TCTGGGAGGGAGGACGGGTGGGG - Intronic
1146123057 17:30211609-30211631 CCTGGGAGGCAGGAAGGGTGGGG + Intronic
1146255473 17:31389689-31389711 CCTGGCAAGGAGGTAGGGAGTGG - Intergenic
1146621477 17:34401886-34401908 CCTGACAAGAAAGAAGGGAGAGG - Intergenic
1146642779 17:34553720-34553742 CCCGGGGTGAAGGAAGGATGAGG + Intergenic
1146659090 17:34652786-34652808 CCTGGGGAGAACAAGGGGTGGGG - Intergenic
1146763249 17:35496481-35496503 AGTCGGAAGAAGGAAGGGTAGGG - Intronic
1147427122 17:40351245-40351267 CGCGGGAGGAAGGGAGGGTGGGG - Intronic
1147484306 17:40797281-40797303 CCTGGAGAGAAGCAAGAGTGTGG + Exonic
1147546084 17:41402796-41402818 CCAGGGAGGAAGGAAGGGAAAGG + Intergenic
1147667965 17:42160544-42160566 CCTGGGAAAAAGGCAGGATGAGG + Intronic
1147700318 17:42389693-42389715 CTTGGGGAGAAGGAATGATGGGG - Intergenic
1147823725 17:43257217-43257239 CGTTGGAAGGAGGAAGGGAGAGG - Intergenic
1147882783 17:43664857-43664879 CCTGGGAAGCAGAGAGGTTGCGG + Intergenic
1148444097 17:47727275-47727297 GCTGAGAGGCAGGAAGGGTGGGG + Intergenic
1148768413 17:50052891-50052913 ACAGAGAAGAGGGAAGGGTGAGG + Intergenic
1148785600 17:50144776-50144798 CCTGGGGAGATGGATGGGGGAGG - Intronic
1149009178 17:51836986-51837008 GCTGGGGAGAAAGAAGGATGTGG + Intronic
1149396941 17:56254789-56254811 CCTGGAAAGAAGGGATAGTGAGG + Intronic
1149455025 17:56780740-56780762 GCTGAGAGGAAGGAAGGGGGTGG + Intergenic
1150350706 17:64442456-64442478 CCTGGGCAGAGGGAGGGATGGGG - Intergenic
1150904298 17:69321145-69321167 ACTGGGATGAAGGAAGAATGTGG + Intronic
1150976391 17:70091809-70091831 CCTGGAAATAAGTAAGGGAGAGG - Intronic
1151069272 17:71189717-71189739 CCGGGGAAGGAGGAAGAGAGAGG + Intergenic
1151305659 17:73261355-73261377 CCTGTAGAGAAGGAAGGGGGAGG + Intronic
1151459500 17:74246096-74246118 CCCTGGAAGAAGGAAGGGGAAGG + Intronic
1151657957 17:75504405-75504427 CCTGGCAGGTAGGAAGGGTCAGG - Exonic
1151980926 17:77507934-77507956 CCTGGGAATGGGGCAGGGTGGGG + Intergenic
1152157749 17:78646043-78646065 CCTCGGAAGGGTGAAGGGTGCGG + Intergenic
1152640129 17:81445823-81445845 ACTGGGAAGAGGGAAGAGAGAGG - Intronic
1152676727 17:81645148-81645170 CCTGGGGAGAGGGAAGGGGCTGG - Exonic
1152720682 17:81922478-81922500 GCAGGGAAGAGAGAAGGGTGGGG + Exonic
1152868040 17:82735823-82735845 CCTGGGAAGGCGGAGGGGTCGGG + Intronic
1152969037 18:143533-143555 TCTGGAAGGGAGGAAGGGTGGGG - Intergenic
1153226419 18:2903416-2903438 CGTGGGAAGAAGGATGGGGAAGG - Intronic
1153503429 18:5771226-5771248 CCTGGGGGGAAGGAATGCTGGGG - Intergenic
1153666320 18:7370225-7370247 CCAGGGAGGAAGGGATGGTGGGG - Intergenic
1154165138 18:12009044-12009066 TCTGGGAGCAAGCAAGGGTGGGG - Intronic
1154383053 18:13869823-13869845 CCTGGGAAGAAGTGGTGGTGAGG - Intergenic
1155144538 18:23072187-23072209 GCTGGGATGAAGGCAGCGTGTGG + Intergenic
1155228429 18:23750718-23750740 CCTTGGAACCAGGAAGTGTGAGG + Intronic
1155294324 18:24371508-24371530 CCTGAGAAGCAGGAAGGGATGGG - Intronic
1155302030 18:24439019-24439041 CCAGGGAAGAATGAATGTTGCGG + Intronic
1155529908 18:26756551-26756573 CCTGGTAAAAAGGAGGGGTGGGG + Intergenic
1155847233 18:30723300-30723322 CATGGGAAGAAGGAAGGTCTAGG + Intergenic
1156365554 18:36423081-36423103 CCGGGGAGGAATCAAGGGTGAGG - Intronic
1156836821 18:41565060-41565082 CCTGGTAAGAAGGAAGTATATGG - Intergenic
1157402701 18:47401136-47401158 CCTGGGTAGAAGGATGATTGTGG - Intergenic
1157403125 18:47402765-47402787 CCTGGGTAGAAGGATGATTGTGG - Intergenic
1157630826 18:49093439-49093461 CCTGGGGAGGAAGAAGGATGTGG + Intronic
1158217506 18:55115510-55115532 CCTGGGAAGAAAGAAGGTCTAGG + Intergenic
1158394392 18:57068408-57068430 ACAGGGAAGAAGGAAATGTGGGG + Intergenic
1159936268 18:74370276-74370298 CCTGGGGAAAGGGAGGGGTGGGG + Intergenic
1161399439 19:4060868-4060890 CCTGGGCAGAGGGTTGGGTGGGG - Intronic
1162025279 19:7890244-7890266 CCTGGGAGGGAGGAGGGGTGAGG + Intronic
1162086931 19:8254843-8254865 CCAGGGAGGCTGGAAGGGTGGGG - Intronic
1162143112 19:8596412-8596434 CCTGGGAAGACGGACATGTGGGG + Exonic
1162219870 19:9167330-9167352 CCAGGGAGGAATGAAGGGAGAGG + Intergenic
1162555438 19:11383340-11383362 CTTGGGAAGATGGCAGGGCGGGG - Intronic
1162612653 19:11768049-11768071 CTTGGGAAGAAAGAAGGGACAGG - Intronic
1163204905 19:15795213-15795235 GCAGAGAAGAAGGAAGGGGGAGG - Intergenic
1163229202 19:15988505-15988527 CCTGGAGAAAAGGAAGGGTGTGG + Intergenic
1163253334 19:16139855-16139877 CCCCAGAGGAAGGAAGGGTGTGG - Intronic
1163430166 19:17262694-17262716 CTTGGGAAGCAGGAAGGGGCAGG - Exonic
1163527554 19:17830797-17830819 CCTGGGAAGAGCTAAGGCTGTGG + Intronic
1163703191 19:18797115-18797137 GGAGGGAAGAAGGAAGGGAGAGG - Intergenic
1164110087 19:22148549-22148571 CCTGGGAAGAACAAGGGGTTGGG + Intergenic
1164503802 19:28841544-28841566 CCTGGAGGGAAGGAAGGATGAGG - Intergenic
1164611057 19:29631971-29631993 CCTGGGAAGATGGAACAGTAGGG + Intergenic
1164646008 19:29859054-29859076 CCTGGGAAGATGGCAGGTCGAGG + Intergenic
1164855452 19:31517371-31517393 CGTGGGAAGAAGGAAGAAGGAGG + Intergenic
1165431921 19:35777732-35777754 CCTGGGAAGAGGTGAGGGTGAGG + Exonic
1165496748 19:36157201-36157223 ACAGGGAAGAAGGAAATGTGGGG + Intergenic
1165823806 19:38694071-38694093 CTAGGGAGGAAGGAAGGATGTGG - Intronic
1165835619 19:38753542-38753564 ACAGGGAAGAAGGAAATGTGGGG - Intronic
1166046272 19:40232853-40232875 CCTGGGGAGAGGGAGGGGTGAGG + Exonic
1166254459 19:41592396-41592418 CCTGGGAAGGAGGGGGTGTGGGG - Intronic
1166656094 19:44613225-44613247 CCTGGGGAGTGAGAAGGGTGAGG + Intergenic
1166863144 19:45821171-45821193 CCTGGGAGGAAGGAAGGAGGAGG + Intronic
1166895252 19:46018534-46018556 CCTGGGGAGAGGGCAGGGTCAGG - Exonic
1167093396 19:47359946-47359968 CCTGGGAGGAAGGGAGGGGGTGG - Exonic
1167292911 19:48634581-48634603 CCTGGGAGGAAGGGAGGAGGAGG - Intronic
1167568925 19:50274963-50274985 GCTGGGGAGAAGGAGGGATGGGG - Intronic
1167612304 19:50513416-50513438 CCTGGGGAGAGGGAAAGGAGAGG + Exonic
1167695113 19:51010535-51010557 CCTGGTGAGAAGGAATGATGAGG - Intergenic
1167952419 19:53037948-53037970 GGAGGGAAGAAGGAAGGGGGCGG + Intergenic
1168105510 19:54163681-54163703 GCTGGGAATGATGAAGGGTGGGG - Intronic
1168227730 19:55008576-55008598 ACAGGGAAGAAGGAAATGTGGGG + Intergenic
1168357303 19:55709931-55709953 CCTGGCAAGAAGGAAGGACACGG - Intronic
925150415 2:1611395-1611417 CCTGGGGAGGAGGAAGGATGAGG + Intergenic
925150532 2:1611865-1611887 CCTGGGGAGGAGGAAGGATGAGG + Intergenic
925270654 2:2604876-2604898 CCAGGGTAGAAGGATGGATGTGG - Intergenic
925531634 2:4869410-4869432 CCTGGAAAGGATGAAGGCTGGGG + Intergenic
925931518 2:8711952-8711974 GCTGGGAGGAGGGAATGGTGGGG + Intergenic
926408016 2:12573685-12573707 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
926917765 2:17909387-17909409 CCTGGGAAGAACAAAGGGTCAGG - Intronic
926926078 2:17988876-17988898 CCTGGGAAGAACAAGGGGTCAGG - Intronic
927093543 2:19730210-19730232 CCTGGGAACACAGAAGTGTGAGG - Intergenic
927255227 2:21035471-21035493 CCTGGGAGGGAGGAATGGAGAGG - Intronic
927333743 2:21896342-21896364 CCTGGGGAGGGGGAAGGTTGGGG + Intergenic
927843426 2:26459205-26459227 ACAGGGAAAAGGGAAGGGTGTGG - Intronic
928059495 2:28096727-28096749 GAAGGGAAGAAGGAAGGGAGTGG - Intronic
928378545 2:30798880-30798902 ACAAGGAACAAGGAAGGGTGGGG + Intronic
928404821 2:31006645-31006667 CCTGGGAAGGATGAAGGAGGAGG + Intronic
928938514 2:36704688-36704710 CCTGGGTAAAACGGAGGGTGTGG - Intronic
928954959 2:36856621-36856643 GCTGGGAATAAGGAAAGGAGGGG + Intronic
929070719 2:38028562-38028584 CCTGGGAAGAAGGGCTGCTGAGG - Intronic
929549550 2:42880628-42880650 CCTGGGATGGAGGCAGGGTACGG + Intergenic
930091301 2:47533419-47533441 GCTGGGAAGCACGATGGGTGAGG + Intronic
930223376 2:48767832-48767854 CCTGGGAAGCACAAGGGGTGAGG - Intronic
930713242 2:54569159-54569181 CCTGGGAAGAAGAAAGGAACGGG + Intronic
931187487 2:59967557-59967579 GGTGGGAAGAAAGAAAGGTGGGG + Intergenic
931283887 2:60816883-60816905 CCTGGGAAGAAGGTGTGCTGGGG - Intergenic
931948541 2:67335747-67335769 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
932291249 2:70581876-70581898 ACTGGTGAGGAGGAAGGGTGGGG - Intergenic
932296114 2:70624648-70624670 ACAGGGAAGAAGGAAATGTGGGG - Intronic
932338315 2:70943547-70943569 GCTGGGAAGGAGGTGGGGTGTGG + Intronic
932426768 2:71642739-71642761 CCTGGGGAGACGGTAGGATGAGG - Intronic
932775075 2:74523537-74523559 CCTGAGAAGAAGGGTGGGTGGGG + Exonic
932791943 2:74661547-74661569 CCTGAGAAGAAAGATGGGTTTGG - Intronic
932852382 2:75199811-75199833 GCTGGGAGGAAGGAAGGATTTGG + Intergenic
933708482 2:85308497-85308519 CGAGGGAAGAAGAAAGGGAGGGG - Intronic
933835565 2:86242805-86242827 CCAAGCTAGAAGGAAGGGTGTGG + Intronic
934523489 2:95034341-95034363 CCTGGGCAGAAGGCAGGCTGGGG - Intronic
934734883 2:96685135-96685157 GTTGGGAAGCAGGAAGGATGTGG + Intergenic
935347861 2:102125082-102125104 CCTGGCAAGCCGCAAGGGTGAGG - Intronic
935815260 2:106841583-106841605 CCTGGGAAGAAGGGGGGTTCCGG + Intronic
936155367 2:110043349-110043371 CCTGAGGATTAGGAAGGGTGGGG - Intergenic
936189313 2:110328064-110328086 CCTGAGGATTAGGAAGGGTGGGG + Intergenic
936664285 2:114576463-114576485 CCTGGCAAGAAGGAAGCCTGGGG + Intronic
936679813 2:114757206-114757228 AATGGGCAGGAGGAAGGGTGGGG + Intronic
937047567 2:118859735-118859757 CCAGGGAAGAAGAAGGGGAGGGG - Intergenic
937277203 2:120692671-120692693 TCAGAGAAGAAGGAGGGGTGAGG - Intergenic
937861991 2:126718600-126718622 CCCGGGAAAAGGGAATGGTGAGG + Intergenic
937916892 2:127103679-127103701 CCTGGGGAGAAGGACAGCTGAGG - Intronic
938016883 2:127874528-127874550 CCAGGGCAGAAGACAGGGTGGGG + Intronic
938176954 2:129142571-129142593 CCTGGCCAGGAGGATGGGTGTGG + Intergenic
938804032 2:134789407-134789429 TCTGGGGACAGGGAAGGGTGAGG + Intergenic
939055523 2:137360420-137360442 CCTGGGAAGCAGGAGGGGTTGGG + Intronic
939350197 2:141027094-141027116 CCTTGGAAGAAGGAAAAGTGGGG + Intronic
940640006 2:156334689-156334711 GCTGGGGAGAAGGAAGGGGGTGG + Intronic
940656127 2:156489839-156489861 GGAGGGAAGAAGGAAGGGAGGGG - Intronic
940875775 2:158895808-158895830 ACTGGGTAGAAGGGAGAGTGGGG - Intergenic
940909863 2:159201183-159201205 CCTGGAAAGTAGGAAGGCTTGGG - Intronic
941373988 2:164705079-164705101 CCTGTGAAGCAGGAAGAGTGAGG - Exonic
941455883 2:165711899-165711921 ACAGGGAAGAAGGAAATGTGGGG + Intergenic
941486405 2:166087388-166087410 CCTGGGAAGCTGGGAGGGAGAGG + Intronic
941935604 2:170979201-170979223 ACAGGGAAGAAGGAAATGTGGGG + Intergenic
942204736 2:173608786-173608808 CCTGGGAGGAAGAAGAGGTGTGG + Intergenic
943350646 2:186792894-186792916 CCTGGGAAGTACAAAGGGTCAGG + Intergenic
943435350 2:187858917-187858939 TCATGGAAGAAGGAGGGGTGGGG + Intergenic
943701671 2:190994399-190994421 ACTGGGAAGGAGGACTGGTGGGG + Intronic
943806891 2:192134346-192134368 ACAGGGAAGAAGGAAATGTGGGG - Intronic
944093633 2:195942337-195942359 TTTGAGAAGAAGGAAGGGTGGGG + Intronic
944355177 2:198778986-198779008 CCTAGGAAGAGGGTAGAGTGGGG - Intergenic
944387701 2:199183306-199183328 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
946084413 2:217156600-217156622 CCTATGAAGAAGGAAGGGACTGG - Intergenic
946549376 2:220783836-220783858 CCTGGTAAGAAGAGAAGGTGTGG + Intergenic
946702035 2:222424254-222424276 CGGGGGAAGAAGGTGGGGTGGGG + Intergenic
947793577 2:232880890-232880912 ACTGCGAAGGAGGAAAGGTGGGG + Intronic
947795262 2:232890366-232890388 CCTGGGAAGGAGCAGCGGTGAGG - Intronic
948296282 2:236863050-236863072 CCTGAGAAGAAGGCAGGGCAGGG - Intergenic
948429498 2:237910022-237910044 CCAGGCTAGAAGGAAGGGAGTGG - Intronic
948596581 2:239083273-239083295 CCTGGGAAGAGAGCAGTGTGAGG - Intronic
948784633 2:240346037-240346059 CGATAGAAGAAGGAAGGGTGGGG - Intergenic
1168876160 20:1173698-1173720 CCTGGGCAGGGGGAAGGGTGTGG + Intronic
1168900312 20:1358306-1358328 CATGGGAAGAAGGAGGAGGGAGG + Intronic
1168979896 20:1995518-1995540 CCTGGGGAGAGGCAAGGGAGGGG - Intergenic
1169593519 20:7171953-7171975 AGAGGGAAGAAGGAAGGGAGTGG + Intergenic
1169927638 20:10799501-10799523 CCTGGGATTAGGGAAGGGAGAGG - Intergenic
1170020679 20:11833907-11833929 GTAGGGAAGAAGGAAGGGTAGGG + Intergenic
1170442217 20:16390609-16390631 CCTGGGTAGAAGAATGGATGAGG - Intronic
1170458347 20:16554092-16554114 CCTGGGTAGAAAGAAGGAGGTGG + Intronic
1170705179 20:18738206-18738228 CCTGGGAAGAATGCGGGGTTTGG + Intronic
1170728078 20:18947783-18947805 CCAGGGATCAAGGAAGGGAGAGG + Intergenic
1171164174 20:22956143-22956165 ACTGGTAAGAGGGAAGGGTGAGG + Intergenic
1171290936 20:23982454-23982476 CCTGGGCAGCAGGAACAGTGGGG + Intergenic
1171542917 20:25978226-25978248 CCTGGGATGAAGGAAGGCAGGGG + Intergenic
1172240269 20:33408404-33408426 CCTGGGCTGAGGGAAGGGAGAGG - Exonic
1172589191 20:36105629-36105651 GATGGGAAGAAGGAGGGGAGGGG + Intronic
1172635602 20:36407793-36407815 CCTGGGAAGAGTGAATGGCGTGG + Intronic
1172932158 20:38594113-38594135 ACAGGGAAGAAGGAAATGTGGGG + Intergenic
1172964267 20:38822825-38822847 GCTGAGTAGAAGGATGGGTGTGG + Intronic
1173102162 20:40097262-40097284 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
1173257943 20:41408318-41408340 GCTGGGAAGAAGAGAGGGTGTGG - Intronic
1173290798 20:41713305-41713327 CTTGGGAAGAAGGAAGGGAGAGG - Intergenic
1173720290 20:45252473-45252495 CTTGGGCAGGAGGAAGGATGTGG - Intronic
1173801684 20:45898261-45898283 TCTGGGAAGAATAAAGGGTTTGG + Intronic
1173924079 20:46767975-46767997 CTTGGGCAGAAAGCAGGGTGGGG - Intergenic
1174391347 20:50220184-50220206 CCAGGGAGGAAGGACAGGTGGGG - Intergenic
1174535095 20:51245220-51245242 TGGGGGAAGAAGGCAGGGTGGGG + Intergenic
1174677573 20:52373200-52373222 CATGGGCAGAAGGAAAGATGTGG - Intergenic
1174774587 20:53332062-53332084 CCTGTGCAGAAGGCAGGGTGGGG + Intronic
1175795224 20:61766688-61766710 CCTGGAAGGAAAGCAGGGTGGGG - Intronic
1176193520 20:63825453-63825475 CCTGGGAAGCCGGGAGGGAGGGG - Intronic
1177100932 21:16896474-16896496 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
1177102962 21:16918133-16918155 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
1177119826 21:17125423-17125445 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
1177159688 21:17534525-17534547 CCTGGGAAGAAGAAAGGCAAAGG + Intronic
1177388135 21:20433454-20433476 CCTGGGGAGAGGGGAGGCTGTGG + Intergenic
1177847815 21:26312091-26312113 CTTGGGAGGAAGGATGGGAGTGG + Intergenic
1178191523 21:30287529-30287551 GGAGGGAAGAAGGAAGGGAGAGG + Intergenic
1178310533 21:31526267-31526289 CCAGGGAAGATGGAAGGCAGCGG + Intronic
1178741535 21:35206511-35206533 AGTGGGAAGAAGGAAGGTCGGGG + Intronic
1178750093 21:35294579-35294601 CATGAAAAGAAGGAAAGGTGTGG - Intronic
1179353542 21:40636397-40636419 AGAGGGAAGAAGGAAGGGGGTGG + Intronic
1179729368 21:43359001-43359023 CCTGGGGAGAGGGATGGGAGTGG + Intergenic
1180082308 21:45492606-45492628 CCTGGGTACAAGGCTGGGTGGGG + Intronic
1180764239 22:18234358-18234380 CCTGGGCAGGAGGGAGGCTGTGG + Intergenic
1180802784 22:18639798-18639820 CCTGGGCAGGAGGGAGGCTGTGG - Intergenic
1180854026 22:19035354-19035376 CCTGGGTAGGAGGGAGGCTGTGG - Intergenic
1180918516 22:19506205-19506227 GCTGGGAAGGAGGAAGAGTGAGG + Intronic
1180943660 22:19677628-19677650 GCTGGGAAGAGGGGACGGTGGGG + Intergenic
1181218934 22:21355463-21355485 CCTGGGCAGGAGGGAGGCTGTGG + Intergenic
1181727353 22:24820641-24820663 ACAGGAAAGATGGAAGGGTGTGG + Intronic
1181786627 22:25231779-25231801 CCTGGGAAGGAGGCATGGTGGGG - Exonic
1181818791 22:25459591-25459613 CCTGGGAAGGAGGCATGGTGGGG - Intergenic
1181940623 22:26473072-26473094 CTTGGCCAGAATGAAGGGTGTGG - Intronic
1182082446 22:27538893-27538915 ACAGGGAAGGAGGAAGGGGGAGG - Intergenic
1182659810 22:31917241-31917263 GCAGGGAAGGAGGCAGGGTGGGG + Intergenic
1182746046 22:32606193-32606215 CCTTGGAAGCAGGAAGGGAAGGG + Intronic
1182799645 22:33021233-33021255 CCTGTGAAGTAGGAAGGGCAGGG - Intronic
1182943402 22:34299843-34299865 CGTGGGAAGAATATAGGGTGTGG + Intergenic
1183238682 22:36639666-36639688 ACTGGGAAGGATGAAGGGTTGGG + Intronic
1183259619 22:36786024-36786046 CCTGGAGGGAAGGAAGGGTCAGG - Intergenic
1183310727 22:37108239-37108261 CCCAGGCAGAAGGAAGAGTGTGG - Intronic
1183332452 22:37228786-37228808 CTGGGGAGAAAGGAAGGGTGGGG + Intronic
1183445944 22:37854995-37855017 CCAGAGAAGCAGGAGGGGTGGGG + Intronic
1183739892 22:39663649-39663671 CCTGGCCAGAAGGAAGGCAGAGG - Intronic
1184331208 22:43829030-43829052 CCTGGGCGGGAGGCAGGGTGGGG + Intronic
1184766767 22:46576466-46576488 CCTGGGGAGATGCAGGGGTGTGG + Intronic
1184968091 22:47995999-47996021 CCTGGGCAGAGGGAAGGCAGTGG + Intergenic
1184977469 22:48072943-48072965 CCTGAGAAGAACAAAGGCTGAGG - Intergenic
1203233242 22_KI270731v1_random:131174-131196 CCTGGGCAGGAGGGAGGCTGTGG - Intergenic
949942727 3:9167147-9167169 CCTGGGCAGGAGAAAGGGGGAGG + Intronic
950670560 3:14522926-14522948 CCTGCGAAGAAGGTGGAGTGGGG - Intronic
951194137 3:19804704-19804726 CCTAGGAAGGGGGAAGGGGGAGG + Intergenic
951607652 3:24453733-24453755 TCTGGGAAGAGGGAAGGGGCCGG - Intronic
952015439 3:28951172-28951194 TCAGGGGAGAAGGAAGGGAGAGG + Intergenic
952316992 3:32239684-32239706 CCTGGGAAGGAGGCAGGGCATGG + Intronic
952420195 3:33123452-33123474 CCAGAGAAGAAGGAAGAGAGCGG - Intronic
952717277 3:36492861-36492883 CCTGGGAAGAAGCCTGGCTGTGG + Intronic
952924955 3:38313971-38313993 TTTGGGAAGCAGGAAGGCTGTGG - Intronic
952960143 3:38583925-38583947 CTTAGGAAGAGGGAAGGTTGGGG - Intronic
953260002 3:41328738-41328760 CCCAGGCAGAAGTAAGGGTGAGG + Intronic
953289804 3:41649656-41649678 CATGGGAAGAAGGCTGGGTGGGG + Intronic
953360068 3:42288211-42288233 ACTTGGAAGAAGGAGGGGTTGGG - Intergenic
953546520 3:43867514-43867536 GCTGCGGAGAAGCAAGGGTGGGG + Intergenic
954036312 3:47852948-47852970 CATGGGAGGAGGGAAGGGAGAGG + Exonic
954314931 3:49795874-49795896 CCAGGGAATCAGGTAGGGTGAGG - Intronic
954356870 3:50089172-50089194 GCTGGCAACAAGGAAGGGCGCGG - Intronic
954392920 3:50276770-50276792 CCTGAAAAGAAGGACGGGTTGGG + Intronic
954731872 3:52670644-52670666 CCTGGGAAGAAGGGAAAATGGGG - Intronic
954794590 3:53155071-53155093 CCTGGGCAGCAGTAATGGTGAGG - Intergenic
955340231 3:58119741-58119763 CCTAGGGAGAAGGAGAGGTGAGG - Intronic
955391511 3:58525697-58525719 CCTGGACAGAAAGAAGTGTGTGG + Intronic
956709508 3:72027133-72027155 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
956885721 3:73557184-73557206 CCTTGTGAGAAGGAAGGCTGAGG - Intronic
956960020 3:74388668-74388690 CCTGTGAAGAAAAAAGGGTAGGG - Intronic
957361651 3:79167098-79167120 CCTGGGAAAAATGAAGTGTTTGG - Intronic
957513077 3:81215089-81215111 TATGGGAAGAAGAAAAGGTGTGG - Intergenic
957695658 3:83635678-83635700 CCTGGGAAGAGTAAAGGGTCAGG + Intergenic
959485520 3:106924499-106924521 ACAGGGAAGAAGGAAATGTGGGG + Intergenic
960101265 3:113745936-113745958 GCGGGGAAGATGAAAGGGTGAGG - Exonic
960171917 3:114472372-114472394 CCTGGGAAAAAGGAAGAAAGAGG + Intronic
960410513 3:117317859-117317881 CCGTGGAAGAACGAAGGTTGGGG - Intergenic
960806691 3:121590493-121590515 CCATGGCAGAAGGAAGGGAGAGG - Intergenic
961170858 3:124796817-124796839 CCTGGGCAGAAGGAAGAGAAGGG + Exonic
961219267 3:125187141-125187163 CCTGGGGAGAAGCGAGGGTGGGG - Intronic
961237046 3:125375675-125375697 CCTGGGGAAATGGAAGGGTCGGG + Intergenic
961237389 3:125378885-125378907 CCTGGGGAAATGGAAGGGTTGGG + Intergenic
961405987 3:126679820-126679842 CATGGGCCGAAGGCAGGGTGAGG + Intergenic
961453501 3:127013254-127013276 CCTGGTGAGAAGGGAGGGTGGGG - Intronic
961464516 3:127073096-127073118 CCTGGCAGGCAGGGAGGGTGGGG + Intergenic
961892304 3:130140446-130140468 ACAGGGAAGAAGGAAATGTGGGG + Intergenic
961993961 3:131221190-131221212 CATGGTAAGCAGGATGGGTGTGG + Intronic
962660923 3:137599622-137599644 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
962672259 3:137720894-137720916 TCTGGAAAGATGGAAGGGAGAGG - Intergenic
962971808 3:140408356-140408378 TCTGGGAACAAAGAAGGGCGGGG + Intronic
963531500 3:146477291-146477313 CCTGGGAAGTGCAAAGGGTGGGG + Intronic
963543392 3:146623948-146623970 CCTGGGCAGAGAGCAGGGTGGGG + Intergenic
963663604 3:148155582-148155604 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
963972306 3:151443552-151443574 CCAGGGAAGTAGGCAGGCTGTGG - Exonic
963988211 3:151622462-151622484 GATGGGAAGGAGGAGGGGTGGGG - Intergenic
965262368 3:166502346-166502368 ACAGGGAAGAAGGAAATGTGGGG + Intergenic
965336615 3:167435363-167435385 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
965639726 3:170819361-170819383 ACAGGGAAGAAGGAAATGTGGGG + Intronic
965803976 3:172523548-172523570 CCTGGGCAGTAGGAAAGGGGAGG - Intergenic
966031389 3:175352298-175352320 GAGGAGAAGAAGGAAGGGTGAGG + Intronic
967993593 3:195150332-195150354 AGAGGGAAGAAGGGAGGGTGTGG - Intronic
967995813 3:195165447-195165469 CCTGGGACCATGGAGGGGTGTGG + Intronic
968134198 3:196209590-196209612 ACAGGGCACAAGGAAGGGTGGGG + Intronic
968151297 3:196338625-196338647 CCTGGGGAGAGCGGAGGGTGAGG - Intergenic
968614117 4:1569665-1569687 CCTGTGGGGGAGGAAGGGTGGGG + Intergenic
968673443 4:1864398-1864420 CCTGGGACGGAGAAAGGCTGGGG + Intergenic
968952849 4:3703521-3703543 CATGGGAAGAAGAGAGGGTGGGG + Intergenic
969003537 4:4001826-4001848 ACAGGGAAGAAGGAAATGTGGGG + Intergenic
969301068 4:6297594-6297616 CCCGTGAAGAAGGCAGGCTGGGG - Intronic
969549010 4:7851932-7851954 CCTGGTCAGAAGCAATGGTGTGG - Intronic
969909253 4:10428333-10428355 CCTGGGAAGCACAAAGGGTTGGG - Intergenic
970256167 4:14172300-14172322 ACAGGGAAGAAGGAAATGTGGGG + Intergenic
970422330 4:15916886-15916908 CCTGGGCAGATGGAATGCTGTGG - Intergenic
970497229 4:16638757-16638779 CCTCGAAAGCAGGAAGAGTGAGG - Intronic
970532983 4:17001599-17001621 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
970948108 4:21719410-21719432 CCTGGTAAGAAGCTGGGGTGAGG + Intronic
971143064 4:23946003-23946025 CCTGGGGAGGAGGGAGGGTCCGG - Intergenic
971509231 4:27403459-27403481 CCTGGGAGAAAGGATGGGAGGGG + Intergenic
971559580 4:28059883-28059905 CCTTTGAAGAAGGAAGAGTATGG - Intergenic
971703657 4:30012560-30012582 CCTGGGAAGCAGGTGTGGTGTGG + Intergenic
971753011 4:30675689-30675711 CCTCACTAGAAGGAAGGGTGAGG - Intergenic
973647719 4:52966995-52967017 CCTGGAGGGAAGGAAGAGTGTGG - Intronic
973826589 4:54713258-54713280 CCTAGGAAGAAGGGTGGGAGGGG - Intronic
975071681 4:70147638-70147660 CCTGAGAAGATGGAGGGATGGGG + Intronic
975887445 4:78982371-78982393 CCTGGGAAGTACAAAGGGTCAGG - Intergenic
976194551 4:82520410-82520432 CCTGAGAAAGAGGAAGGATGGGG - Intronic
976397591 4:84572811-84572833 CATGTGGAAAAGGAAGGGTGAGG - Intergenic
978465641 4:109005825-109005847 TCTGGGAAAATGGAAGGGTATGG - Intronic
978587057 4:110284567-110284589 CCTGGGACTTAGGAAGGCTGAGG + Intergenic
979180306 4:117718344-117718366 CCTGGGAAGTAGACATGGTGTGG - Intergenic
979317335 4:119279909-119279931 CCTGGGAAGCACGAGGGGTCAGG - Intronic
979894917 4:126146926-126146948 ACAGGGAAGAAGGAAATGTGGGG + Intergenic
980251456 4:130320702-130320724 CCCTGGAACCAGGAAGGGTGAGG - Intergenic
980344588 4:131596405-131596427 GAAGGGAAGAAGGAAGGGAGAGG - Intergenic
980393833 4:132182187-132182209 CCAGGGAATAAGGAAGCCTGAGG + Intergenic
981142961 4:141291733-141291755 CCTGGGCAGCAGGCATGGTGCGG + Intergenic
981311379 4:143301180-143301202 TCTGGGAAGAAGTAAAGATGAGG + Intergenic
981776078 4:148369078-148369100 CCTGGGAAGAAGTGGGGCTGGGG + Intronic
982396477 4:154920631-154920653 ACAGGGAAGAAGGAAATGTGGGG + Intergenic
982496868 4:156105261-156105283 ACAGGGAAGAAGGAAATGTGGGG + Intergenic
983083091 4:163412099-163412121 GCTGGGAAGAAGGAAGGTAAAGG + Intergenic
983544385 4:168947534-168947556 CTTGGGGAGAAGGATGGGAGAGG - Intronic
984092118 4:175387474-175387496 CCTGTGAGGAAGGATGGGTCAGG - Intergenic
984322435 4:178211022-178211044 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
984484608 4:180352419-180352441 CCAGAGCAGAAGGAAGGGTTTGG + Intergenic
984621616 4:181959426-181959448 TGTGTGAAGAAGGAAGGGAGTGG + Intergenic
984758553 4:183344974-183344996 CCTTGGAAGCAGGATGGCTGGGG - Intergenic
984842619 4:184082176-184082198 CGTGGGAAGCAGGCAGGGGGCGG + Intergenic
984877986 4:184386333-184386355 GTTGGGAAGAAGGAAGGGGGAGG + Intergenic
985009833 4:185570688-185570710 CTTGGGAAGGAAGAAGGGAGGGG + Intergenic
985435990 4:189929998-189930020 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
985573811 5:664561-664583 CCTGGGCAGAGGGCAGAGTGAGG - Exonic
986773501 5:10994339-10994361 CCGGGGAAGGAGGAGGGGGGCGG + Intronic
987427274 5:17787403-17787425 CCTGTGAAGGGTGAAGGGTGAGG - Intergenic
987906802 5:24088266-24088288 CCTGGGATGAAGGGACTGTGGGG + Intronic
987935971 5:24465212-24465234 CCTGGAAACATTGAAGGGTGAGG - Intergenic
988699642 5:33660728-33660750 CCTGGGAAATAGCATGGGTGTGG - Intronic
988772662 5:34448056-34448078 CCTGGGAAGCACAAGGGGTGGGG - Intergenic
989568331 5:42923576-42923598 ACTGGGCTGAAGGCAGGGTGTGG - Intergenic
990033564 5:51291880-51291902 CCTGGGAAGAAGCAAGGGATGGG + Intergenic
990456715 5:55995354-55995376 CCTGGCGAGAAGGGAGGGCGGGG - Intergenic
990898483 5:60725279-60725301 GCTGGGGAGAAGGCAGAGTGGGG - Intergenic
991035034 5:62120609-62120631 CTTGTGAAGAAGGAAGTATGTGG - Intergenic
991236627 5:64406844-64406866 CCTGGGAAGCAGAAAGGGTCAGG + Intergenic
991280802 5:64910889-64910911 CCTGGGAAGCACAAAGGGTAGGG - Intronic
991913484 5:71584075-71584097 CCTGGGCAGAGGGAACGGTGCGG + Intergenic
992008192 5:72500062-72500084 ACTGGGAAGAGGGAGGCGTGTGG + Intronic
992287215 5:75248025-75248047 CCTGGAAAGCACGAAGGGTCAGG + Intergenic
992613069 5:78524147-78524169 CCTGAGAAGGAGGCTGGGTGTGG - Intronic
992766218 5:80003101-80003123 CCTGGGATGGAGAAAGGGTAGGG + Intronic
993333586 5:86629714-86629736 CCTGGGAAGAAGAGAAGCTGTGG + Intergenic
993442897 5:87978500-87978522 CCTGTGATGGAGGAAGGGTTTGG - Intergenic
993538643 5:89120270-89120292 CCTAGGAAGAGGGAAGGGAAAGG + Intergenic
994331337 5:98509835-98509857 ACTGGGGAGAAGGAAGGGCTAGG + Intergenic
994452107 5:99955915-99955937 CCTGGGAGGAAGAAAGGGGTGGG - Intergenic
994532300 5:100986036-100986058 GCAGGGAAGAAGGAAATGTGGGG + Intergenic
994778704 5:104065976-104065998 ACAGGGAAGAAGGAAATGTGGGG + Intergenic
994968442 5:106703867-106703889 GTGGGGAAGAAGGAAGGGTGTGG - Intergenic
995296922 5:110533766-110533788 ACAGGGAAGAAGGAAATGTGGGG - Intronic
995426565 5:112030002-112030024 CCTGGGATCAAGGAAGTTTGAGG + Intergenic
995666192 5:114544925-114544947 CCAGTGAAGAAGGATGGGTCAGG - Intergenic
995899120 5:117048154-117048176 ACAGGGAAGAAGGAAATGTGGGG + Intergenic
996786257 5:127239893-127239915 GCTGGGTAGAAGTAAGGATGAGG - Intergenic
997360776 5:133293395-133293417 CCAGGGAAGCATGGAGGGTGTGG - Intronic
997363403 5:133309807-133309829 CTTGGGTATAAGGCAGGGTGAGG - Intronic
997461952 5:134058887-134058909 CCTGGGGAGAGGGCAAGGTGGGG - Intergenic
997521628 5:134527209-134527231 GGTGGGAAGAAGGGAGGGAGAGG - Intronic
997688804 5:135811213-135811235 CCTGGGAAGGAGGATGGGCAGGG + Intergenic
997708851 5:135986118-135986140 AAAGGGAAGAGGGAAGGGTGAGG - Intergenic
998695154 5:144630529-144630551 CCTGGGTTTAAGGAGGGGTGAGG - Intergenic
998780457 5:145650969-145650991 CCTGGGAAGCACAAAGGGTCAGG + Intronic
998870473 5:146546656-146546678 CCTAGGAAGGAGGGAGGGTAAGG + Intergenic
998898031 5:146821054-146821076 CCTGGTGAGAAGCCAGGGTGTGG - Intronic
999127809 5:149259258-149259280 CCTTGAAAGAGGGAAGGGTCAGG - Exonic
999196048 5:149782480-149782502 TCGGGGAAGAAGGAAGGATGTGG + Intronic
999369872 5:151048179-151048201 CCGGGGAAGGAGGAAGAGGGTGG + Intronic
999371753 5:151059975-151059997 CCGGGGGAGAAAGAAGGGTCAGG - Intronic
999403234 5:151283655-151283677 CCTTGGAAAAATGAAGGCTGTGG + Intronic
999721792 5:154404078-154404100 CATGGCAAGAAGGAAGAGAGAGG - Intronic
999774398 5:154800437-154800459 CCTCAGAAGAAGGAAGGGAGAGG + Intronic
1000264304 5:159619926-159619948 CCTGCTAAGAAGGGAGGATGGGG + Intergenic
1001076062 5:168628912-168628934 CCTGAGAAGGCAGAAGGGTGGGG + Intergenic
1001331199 5:170763824-170763846 ACAGGGAAGAAGGAAATGTGGGG + Intronic
1001506209 5:172283157-172283179 CCACAGAACAAGGAAGGGTGCGG + Intronic
1001586431 5:172836098-172836120 CTTGGTAAGACGGAAGGGTGAGG - Intronic
1001591591 5:172869190-172869212 CCTGGGGAGGAGGAAGGAGGAGG + Intronic
1001867266 5:175116506-175116528 GCTGGGAAGGAGAAAGGGAGAGG - Intergenic
1001884819 5:175279921-175279943 CCTAGGAAGGAGGAAAGGTCAGG + Intergenic
1001983318 5:176051954-176051976 CCTGGGAAGCGGGAGGGGTCAGG + Intronic
1002234147 5:177792098-177792120 CCTGGGAAGCGGGAGGGGTCAGG - Intronic
1002297874 5:178241408-178241430 TCTGGGAAGGAGGAAGGAAGGGG + Intronic
1002350904 5:178582957-178582979 CCTGGGAAGAAGGGAGTGAAAGG - Intronic
1002614471 5:180442205-180442227 CCTGGGAGGGAGGAAGGGACAGG + Intergenic
1002761938 6:209185-209207 CCTAGGAAGAAGAAAGGGGAAGG + Intergenic
1002788304 6:420443-420465 CCTGGAAAGCAGGGAGGGTCAGG - Intergenic
1002858444 6:1058433-1058455 CCAGGGAAGAAGGCACTGTGGGG + Intergenic
1003117015 6:3289701-3289723 CCAGGGAAGAAGGTGGGGAGTGG - Intronic
1003508964 6:6763450-6763472 CCCGGGAAGAAGCAAGGGACAGG + Intergenic
1003904525 6:10687214-10687236 CCTGGAAAGAAGAAAGGGTTTGG - Intronic
1004122697 6:12840054-12840076 CCTGGGTAGCAGCAAGGATGGGG - Intronic
1004768320 6:18755849-18755871 ACAGGGAAGAAGGAAATGTGGGG + Intergenic
1004837289 6:19543048-19543070 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
1005509071 6:26495845-26495867 TCTGGGAAGAATGAAGAGAGGGG + Intergenic
1006174774 6:32115343-32115365 ACTGGGAGTAAGGGAGGGTGGGG - Exonic
1006422093 6:33941353-33941375 CAAGGGAAGGAGGAAGGGAGAGG - Intergenic
1006439278 6:34043150-34043172 CCTGGGATGGAGCAGGGGTGGGG - Intronic
1006718013 6:36132378-36132400 GCTGGGGAGAAGGGAAGGTGGGG - Intronic
1007167008 6:39835833-39835855 TCTTGGGAGAAGGGAGGGTGGGG + Intronic
1007385546 6:41518068-41518090 CCAGGGAGGAAAGAAGGGAGAGG - Intergenic
1007395665 6:41576192-41576214 CCAGGGAAGGAGGTGGGGTGGGG + Intronic
1007494529 6:42250589-42250611 CCTAGAGAGAAGGGAGGGTGTGG - Intronic
1007616852 6:43184917-43184939 CCAGGGAAGAAGGAAAGGAATGG + Intronic
1007690784 6:43699811-43699833 CCTGGAAGGAAGGAACGGGGTGG + Intergenic
1007777762 6:44233336-44233358 TCTGGGTGGAAGGAGGGGTGGGG - Intronic
1007948791 6:45850912-45850934 CCTGGAAAGCAGAAAGGCTGAGG + Intergenic
1007989773 6:46243134-46243156 CATGGGGAGGAGGAAGGGTGTGG + Intronic
1008985538 6:57538121-57538143 ACTGGGAAGAATGAAGTGGGAGG - Intronic
1009384889 6:63076226-63076248 CCTGGGAAGCACAAAGGGTTGGG - Intergenic
1009840217 6:69061802-69061824 CCTGGGAGCATGGAAGGGTAGGG + Intronic
1010130507 6:72487320-72487342 CATGGGGAGAAGGATAGGTGAGG - Intergenic
1011142222 6:84171106-84171128 CAAGGGAAGCAGGAACGGTGAGG - Intronic
1011449320 6:87476041-87476063 TCTGGGAATAAGGAAGTATGAGG + Intronic
1011775141 6:90721728-90721750 CCTGGGACCAAAGAAGGGTGAGG + Intergenic
1012675345 6:102105887-102105909 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
1013071755 6:106735885-106735907 CCTGATAAAAAGGAAGGGTTTGG + Intergenic
1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG + Exonic
1013387378 6:109645264-109645286 CCTGGGAAGCACAAGGGGTGGGG + Intronic
1014406396 6:121057366-121057388 CCTGGTATGAAGGACAGGTGAGG + Intergenic
1014787232 6:125632993-125633015 CCTGGTAAGAGGGAAGGATGAGG - Intergenic
1014947285 6:127514518-127514540 TCTGGGCAGAAGCAAGGGCGTGG - Intronic
1014950199 6:127545342-127545364 CAGGGATAGAAGGAAGGGTGGGG - Intronic
1015165488 6:130196459-130196481 ACAGGGAAGAAGGAAATGTGGGG - Intronic
1016204810 6:141456958-141456980 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
1016387250 6:143540410-143540432 CCTGGAAAGAAGGATGGAGGTGG - Intronic
1016417779 6:143851120-143851142 CCTGCCCAGAAGGAAGGGTATGG + Intronic
1016519055 6:144927102-144927124 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
1017170903 6:151453149-151453171 CCTGGGCAGAAAGTAGGTTGAGG + Intronic
1017399288 6:154040378-154040400 GCAGGGGAGAAGAAAGGGTGGGG - Intronic
1017694402 6:157000119-157000141 TCTGGGTAGAAGGATGGCTGAGG + Intronic
1017819321 6:158038291-158038313 CCTGGGAGTAAGGTTGGGTGGGG - Intronic
1017820237 6:158043940-158043962 CCTGGGAAGAGCACAGGGTGGGG + Intronic
1017893151 6:158655907-158655929 ATTGGGCAGAAGGAAGAGTGGGG + Intronic
1017912088 6:158802113-158802135 CCTGGCAAGAAGGAATGGGTGGG - Intronic
1018152969 6:160957080-160957102 CCAGGGAAGAAGGTAGGGGGTGG + Intergenic
1018650028 6:165985838-165985860 GTGGGGAAGAAGGGAGGGTGGGG - Intronic
1018712561 6:166507143-166507165 CCTGGGAAGAGGGAGGGAAGAGG - Intronic
1018930941 6:168239879-168239901 TCTGGGTTGAAGGATGGGTGAGG + Intergenic
1018931093 6:168240895-168240917 CCTGTGATCAAGGAAGGGTCAGG + Intergenic
1018984358 6:168625085-168625107 CCTGGGAGGAAGGGCGGGGGCGG - Intronic
1019150228 6:170000615-170000637 GATGGGAAGGAGGATGGGTGGGG + Intergenic
1019298280 7:290352-290374 CCTGGGACGAAGGAAGGGCGGGG + Intergenic
1019552538 7:1610350-1610372 CATGGGAAGACGAAAGGGTGCGG - Intergenic
1019574230 7:1728582-1728604 CATGGACAGAAGGAAAGGTGGGG - Intronic
1019611742 7:1940191-1940213 CCTGGGAAGGAGGAGGGGAGGGG + Intronic
1019726954 7:2608098-2608120 CAGGGGGTGAAGGAAGGGTGAGG + Intronic
1019783605 7:2959302-2959324 CATGGTAAGAGGGAAAGGTGGGG + Intronic
1019803768 7:3107549-3107571 CCTGTGAAGAGGGAACAGTGTGG + Intergenic
1019812652 7:3175768-3175790 GCAGGGAAGAGGGAAGGCTGGGG + Intergenic
1020111814 7:5451877-5451899 CCTGGGAGGAGGGGAGAGTGGGG - Intronic
1020416822 7:7956069-7956091 CCTGATAGGAAGGCAGGGTGTGG - Intronic
1020540851 7:9460115-9460137 ACAGGGAAGAAGGAAATGTGGGG + Intergenic
1020590136 7:10124954-10124976 CCTGGGAAGCACAAAGGGTCAGG - Intergenic
1020774173 7:12432288-12432310 CCTGGGAAGCACAAAGGGTAGGG - Intergenic
1022033615 7:26514421-26514443 CCAGGGAAGAGGGAAGGCAGGGG - Intergenic
1022572509 7:31468600-31468622 ACAGGGAAGAAGGAAATGTGGGG + Intergenic
1022666545 7:32416344-32416366 CCCTGGAAGAGGGAAGGATGTGG + Intergenic
1022709357 7:32836506-32836528 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
1022971307 7:35519898-35519920 TCTGGGGTGAAAGAAGGGTGTGG - Intergenic
1023141603 7:37107920-37107942 CTTGAGAAGATGGAAAGGTGAGG + Intronic
1026875387 7:73876448-73876470 CCTGGCACGAAGGAAGGGCCCGG - Intergenic
1026892765 7:73992114-73992136 CCTGGGCAGCAGACAGGGTGAGG + Intergenic
1026898767 7:74025954-74025976 CCTGGGAAGGAGGAAGGCAGGGG - Intergenic
1028058865 7:86283986-86284008 CTAGGGAAGAAGGAAATGTGGGG - Intergenic
1028121302 7:87059327-87059349 CCTGGCAAGGAGGAAGCGGGCGG + Exonic
1029221418 7:98993665-98993687 CCAGGGAAGACAGAAGGGTGGGG - Exonic
1029253564 7:99253590-99253612 TCTGGGAAGAGCGAAGCGTGGGG + Intergenic
1029413112 7:100427888-100427910 GGTGGGAGGAAGGAAGGGAGGGG - Intronic
1029459930 7:100688604-100688626 CCCGGGAAGAAGGAGGGCAGGGG + Exonic
1029551543 7:101239454-101239476 AAAGGGAGGAAGGAAGGGTGTGG + Intronic
1030500889 7:110357043-110357065 CCTGGGAAGCACAAAGGGTCAGG - Intergenic
1030686684 7:112494147-112494169 CCTGGGAACTCCGAAGGGTGAGG + Intergenic
1030762612 7:113370032-113370054 CCAGGACCGAAGGAAGGGTGAGG - Intergenic
1030869896 7:114742527-114742549 CAAGGGAAGAAGGAAGGCTTTGG + Intergenic
1031519103 7:122741311-122741333 CTAGGGAAGAAGGATGGCTGTGG + Intronic
1031777620 7:125921716-125921738 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
1031858451 7:126949777-126949799 CAGAGGAATAAGGAAGGGTGGGG + Intronic
1031894073 7:127327838-127327860 TCTGGGAAGAAGGAAAACTGAGG + Intergenic
1032112905 7:129091839-129091861 TTTGGGAAGCAGAAAGGGTGAGG - Intergenic
1032262331 7:130347451-130347473 CAGGGGAAGAAGGAAGGGAAAGG - Intronic
1032455297 7:132068593-132068615 TCTGGTGAGAAGGAAGGGGGTGG - Intergenic
1033075275 7:138244117-138244139 AATGGGAAGGAGGAAGGGAGTGG - Intergenic
1033078765 7:138274423-138274445 CTTGGGGAGAAGGATGGGAGTGG + Intergenic
1033321412 7:140343107-140343129 CCTGGAAAGAAAGAAGGGGATGG + Intronic
1033442112 7:141389523-141389545 GCTGGGAAGATTGATGGGTGTGG + Intronic
1033658883 7:143390556-143390578 CCTGGGAAGAAGGAAGGGTGAGG - Exonic
1033659099 7:143391535-143391557 CCTGTGGGCAAGGAAGGGTGGGG + Exonic
1033705459 7:143882065-143882087 CCTGGGAGGAAAGAAGAGAGTGG - Intronic
1033825758 7:145187117-145187139 CCTGGAAGGAAGGAAGGGAAGGG - Intergenic
1033977173 7:147116530-147116552 CCTGGGAAGAAGAATGGATGGGG + Intronic
1034127487 7:148686578-148686600 TGTGGGAAGAAGCAAGGGAGAGG - Intergenic
1034357819 7:150466863-150466885 CCTGAGAGAAAGGAAGGTTGTGG + Exonic
1034671843 7:152865074-152865096 CCTGGTAAAAGGGGAGGGTGGGG - Intergenic
1034729591 7:153374831-153374853 CCTGGGATAGGGGAAGGGTGTGG - Intergenic
1034843271 7:154419567-154419589 CCAGGGCAGAACCAAGGGTGTGG - Intronic
1035044118 7:155952850-155952872 CCTGGTAGGAAGCAAGGATGTGG + Intergenic
1035119017 7:156549440-156549462 TCTGGGAAGAAGAAAGGCTTTGG - Intergenic
1035555691 8:565630-565652 CCTGAGAAGAAGGAGTGGCGTGG - Intergenic
1035707472 8:1688231-1688253 CCTGGGAACAGAGAAGGGAGGGG - Intronic
1036373533 8:8181032-8181054 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
1037128820 8:15383546-15383568 TTGGGGAAGAAGGAAGGATGTGG - Intergenic
1037754197 8:21700819-21700841 CCTGGATGGGAGGAAGGGTGGGG - Intronic
1037755052 8:21705125-21705147 CCTGGGCAGGAAGAAAGGTGGGG + Exonic
1037814301 8:22103717-22103739 CCTGGGCAGAAGGGAGGGCAAGG - Exonic
1037865711 8:22440964-22440986 CGCGGGAAGGCGGAAGGGTGGGG + Intronic
1038247352 8:25871165-25871187 CCAGGGAAGTAGGGAGGGGGAGG - Intronic
1039421932 8:37450566-37450588 GCTGGGAAGAAGGGAGAGTCAGG + Intergenic
1039440964 8:37595074-37595096 GCTGGGTGGAAGGAGGGGTGGGG + Intergenic
1041008251 8:53516404-53516426 TCTTGGAAGAAGGAAGGAGGGGG + Intergenic
1041134124 8:54737580-54737602 TCTGGGAATAAGGAAGTGGGGGG + Intergenic
1041526509 8:58812476-58812498 ACTGGAAAGTGGGAAGGGTGTGG - Intronic
1041600961 8:59716924-59716946 CCTGGGAAGAAGAAGGGTTTGGG - Intergenic
1041709014 8:60876246-60876268 CCTGGGAAGGAGGAAACCTGAGG - Intergenic
1041713374 8:60912753-60912775 CTTTGGAAGAAGAAAGGATGGGG + Intergenic
1041762192 8:61379067-61379089 CATGGGAGGAAGGAAGCATGTGG - Intronic
1041789039 8:61670922-61670944 CCCTGGAAGAAGGAAGGTTGTGG + Intronic
1041799503 8:61783965-61783987 CCTGAGAACCAGGAAGGCTGAGG + Intergenic
1043358342 8:79440278-79440300 CTGGGGAAGTAGGAAGGGGGTGG + Intergenic
1043916813 8:85932403-85932425 GCTGGGGAGAAGGAAGAATGAGG + Intergenic
1043938900 8:86174323-86174345 CCTGGGAAGCAGAAGGGGTGGGG - Intergenic
1044291478 8:90475802-90475824 CATGGGCAGAAGGAAGCATGAGG - Intergenic
1045251259 8:100485074-100485096 GCTGGGAAGTAGGATGGATGTGG + Intergenic
1045713937 8:105019544-105019566 GCTGGGAAGAAGGCAGGTGGAGG + Intronic
1047046621 8:121060849-121060871 CCTGGGAATAGGGAAGGGAAGGG + Intergenic
1047344930 8:124018449-124018471 TCTGGGACGAAGGATGGATGAGG - Intronic
1047486561 8:125336190-125336212 CCAGGGAAGAAGGAAAGGAAAGG + Intronic
1047706373 8:127503662-127503684 CCTAAGAAGGAGGAAGGGAGTGG + Intergenic
1048135739 8:131744859-131744881 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
1048285805 8:133140811-133140833 AGAGGGAAGAAGGAGGGGTGGGG - Intergenic
1048319433 8:133386898-133386920 CTTTGGAAGAGGGAGGGGTGGGG - Intergenic
1048320984 8:133400036-133400058 CATGGGGAGAAGGCAGGATGGGG - Intergenic
1048445091 8:134487386-134487408 CCTGTGAGGAAGGCAGGGTGAGG + Intronic
1048585177 8:135768931-135768953 ACAGGGAAGAAGGAAATGTGGGG + Intergenic
1048728145 8:137409846-137409868 ACAGGGAAGAAGGAAATGTGGGG + Intergenic
1048763958 8:137826387-137826409 ACAGGGAAGAAGGAAATGTGGGG + Intergenic
1048855100 8:138680211-138680233 TGTGGGAGGAAGGAAGTGTGGGG + Intronic
1048934456 8:139343498-139343520 TCTGGGTAGCAGGGAGGGTGTGG + Intergenic
1049434318 8:142579433-142579455 CCTGGGAAGGAGGGAGGAGGAGG + Intergenic
1049551363 8:143261450-143261472 CCAGGGACGCAGGAAGGATGGGG + Intronic
1049797864 8:144504749-144504771 CCTGGGAAGACGGAGTGCTGAGG - Exonic
1049958338 9:713484-713506 CCTGGGAATGAGGAAGGATGGGG + Intronic
1050071374 9:1818175-1818197 CCTGGGGAGAAGGAATGAAGTGG + Intergenic
1050137463 9:2481804-2481826 CCTGGAAAAAGGGAAGGGTGAGG - Intergenic
1050257807 9:3812734-3812756 GCAGGGAAGAAGGAAATGTGGGG + Intergenic
1051191778 9:14520422-14520444 CCTTGGAAGAAGGACAGGTTGGG - Intergenic
1051431478 9:16984739-16984761 CCTGGGAGGAAGGAAGGGCAGGG + Intergenic
1051541900 9:18229424-18229446 CCTGGCAGGGTGGAAGGGTGGGG - Intergenic
1052546655 9:29889009-29889031 CCAGTGAAGAAGGATGGGTCAGG - Intergenic
1052653596 9:31330338-31330360 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
1052740434 9:32387117-32387139 CCTATGTAGAAGGAAGAGTGGGG - Intronic
1052746709 9:32448615-32448637 CCTGGGAAGCACAAAGGGTCAGG - Intronic
1053145428 9:35708484-35708506 CCTGGGAAGAGAAAAGGGGGTGG + Exonic
1053147811 9:35723841-35723863 CCTCGGAAGAAGAAATAGTGGGG + Intronic
1053149240 9:35732313-35732335 CCTGGCAGGAAGCGAGGGTGCGG + Exonic
1053364338 9:37511987-37512009 CCTGGGAGGAAGGAAGGACCTGG - Exonic
1053462299 9:38280390-38280412 CCTGGGAAGAAGGGAGTCTCAGG - Intergenic
1053472703 9:38358243-38358265 GCTGGGAGGTAGCAAGGGTGGGG - Intergenic
1053492438 9:38518915-38518937 AGGGGGAAGAGGGAAGGGTGAGG + Intergenic
1053847121 9:42250691-42250713 CCTGGGAAGAAGAAGGGGCTGGG + Intergenic
1054453925 9:65420109-65420131 GGAGGGAAGAAGGAAGGGAGGGG + Intergenic
1054807195 9:69406318-69406340 ACAGGGAAGAAGGAAATGTGGGG + Intergenic
1054827196 9:69585416-69585438 CCTGGCAAGAATGAAGGAAGCGG - Intronic
1054926299 9:70592028-70592050 CATGGAAAGAAGGAAGAATGAGG - Intronic
1055958698 9:81798915-81798937 ACGGAGAACAAGGAAGGGTGAGG - Intergenic
1056323163 9:85455829-85455851 CATGGGAAGATGAAAGGGAGTGG + Intergenic
1056626550 9:88258276-88258298 CCTGGGCAGATGAAAGGGTGAGG + Intergenic
1057116751 9:92530844-92530866 CATGGGAAGAAGGCAGGGAGAGG - Intronic
1057489674 9:95511224-95511246 CCGGGGAGGAAGGAAGGGGGCGG - Intronic
1057717088 9:97503239-97503261 CCTGAGCAGTGGGAAGGGTGCGG - Intronic
1058010034 9:99966920-99966942 TCTGGGTAGAAGGAATGTTGAGG - Intronic
1058612677 9:106792488-106792510 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
1058802729 9:108560593-108560615 CTGAGGCAGAAGGAAGGGTGAGG - Intergenic
1058923517 9:109640462-109640484 CCTGGGGAGAAGGGTGGGTGGGG - Intergenic
1059343610 9:113613448-113613470 CATGAGGAGGAGGAAGGGTGTGG + Intergenic
1059408751 9:114118762-114118784 CCTGGGAAGAGGGGCTGGTGAGG + Intergenic
1059426053 9:114221701-114221723 CCCTGGAAGAAGGAAATGTGAGG + Intronic
1059574124 9:115472186-115472208 CCTGGGAAAAACCAAGAGTGGGG - Intergenic
1059825793 9:118027510-118027532 CCAGGGCAGAAGGAAGGGGCGGG - Intergenic
1060318220 9:122532417-122532439 ACAGGGAAGAAGGAAATGTGGGG + Intergenic
1060543044 9:124444357-124444379 CCTGGGAGGAAGGTGGGGTAGGG + Intergenic
1060640273 9:125232402-125232424 CCAGGGAGGAAGGCAGGGAGGGG - Intronic
1060779492 9:126401028-126401050 CCAGGTCAGCAGGAAGGGTGGGG - Intronic
1061022793 9:128027084-128027106 CCTGGGAGGAGGGAAGGGCAGGG - Intergenic
1061077015 9:128347943-128347965 CCAGGGAAGAAGAGAGGGTTGGG + Intronic
1061168058 9:128936041-128936063 CCTGGGAGGCAGGACTGGTGTGG - Intronic
1061187542 9:129063522-129063544 CTAGGGAAGGAGGAAGGGAGGGG - Intronic
1061661073 9:132130729-132130751 TCTGGGAAGAGGGCGGGGTGAGG - Intergenic
1062057327 9:134475356-134475378 CCGGGGAAGCAGGAGGGGTTCGG + Intergenic
1062091473 9:134680766-134680788 CAGGGGCAGAAGGACGGGTGAGG + Intronic
1062111698 9:134785465-134785487 CCTGGCAGGAAGGAAGGCCGGGG + Intronic
1062340248 9:136090928-136090950 CCTGGGAAGCAGGCAGGGCTGGG - Intronic
1062447186 9:136599892-136599914 CCTGGGAAGCCGGAGGGGAGTGG + Intergenic
1062529333 9:136992986-136993008 GCAGGGAGGAAGGACGGGTGGGG + Intronic
1062562966 9:137149986-137150008 CCAGGGCAGAACGCAGGGTGGGG + Intronic
1186022833 X:5275840-5275862 CCTGGGCACAGGGTAGGGTGGGG - Intergenic
1186356116 X:8792270-8792292 GCTGGGAAGAGGGAAGGGCTAGG + Intronic
1186377867 X:9026475-9026497 GCTGGGAAGACGGAAGGGCTGGG + Intronic
1186619828 X:11227571-11227593 GCTGGGAAGAGGGAAGGGCTAGG - Intronic
1187313947 X:18174415-18174437 TCTGGAAAGAAGGAAAGGGGTGG + Intronic
1187784238 X:22866560-22866582 CCTGGGAAGCACAAAGGGTCAGG + Intergenic
1187904636 X:24054580-24054602 CCTGGGAATCAGCTAGGGTGTGG - Intergenic
1188024096 X:25190153-25190175 GATGGGAAGAGGGAAGGGAGGGG + Intergenic
1188893368 X:35636623-35636645 CCTGGGAAGCACAAGGGGTGGGG - Intergenic
1189208121 X:39259310-39259332 GCTGAGAAGAAGGAAGGGGGAGG - Intergenic
1189320320 X:40083568-40083590 CCGGCGAAGAAGAAAGGGGGAGG + Intronic
1189341513 X:40207951-40207973 CTGGGGAAGAAGGAGGGGGGTGG + Intergenic
1189381724 X:40506950-40506972 CCTGGGGAGAGGGGAGTGTGGGG + Intergenic
1189773808 X:44452121-44452143 ACTGAGATGCAGGAAGGGTGAGG + Intergenic
1190064919 X:47233242-47233264 CCTCGGCAGAGGGAACGGTGGGG + Intronic
1190630584 X:52381522-52381544 CCTGGGAAGTGGGAATGCTGTGG + Intergenic
1190681336 X:52829782-52829804 CCTGGGAACTGGGAAGGCTGCGG - Intergenic
1190812661 X:53899752-53899774 CTTGGCAAGAAGTAAGGGTGGGG - Intergenic
1190964025 X:55280511-55280533 CCTGGGAACTAGGAACGCTGTGG + Intronic
1191757315 X:64607422-64607444 CCTGGGAAGCACAAGGGGTGAGG - Intergenic
1191761593 X:64653209-64653231 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
1191857565 X:65639534-65639556 CCAGGGAAGTGGGAAGGGTGTGG + Intronic
1192092157 X:68170977-68170999 TCTGGGAAGAAGCAGGGGAGTGG + Intronic
1192138789 X:68630527-68630549 AGTGAGAAAAAGGAAGGGTGGGG + Intergenic
1192146995 X:68688766-68688788 AGTGAGAAAAAGGAAGGGTGGGG - Intronic
1192207973 X:69108684-69108706 CCTGGGAAGCAGGGCTGGTGAGG + Intergenic
1192208291 X:69110377-69110399 CCTGGGAGGAAGGAGGGGATGGG - Intergenic
1192542751 X:71989114-71989136 CCTGGTGAGAAGGGTGGGTGGGG - Intergenic
1193216957 X:78875285-78875307 CCAGTGAAGAAGGATGGGTTGGG - Intergenic
1193363203 X:80599639-80599661 CCTGGGAAGAACAAGGGGTCAGG - Intergenic
1193582857 X:83286494-83286516 CCTGGGAAGAACAAAGGGTCAGG + Intergenic
1193661890 X:84267824-84267846 CCTGGGAAGCACAAGGGGTGGGG - Intergenic
1193780754 X:85698816-85698838 CCTGGGGAGAGGGATGGCTGCGG - Intergenic
1194733714 X:97486917-97486939 TCTGGGGAGAAGGAGGAGTGGGG - Intronic
1195259977 X:103122418-103122440 TCTGGGAAGCAGGAATGGGGAGG - Intergenic
1195440752 X:104895714-104895736 CCTGGGAAGAACAAGGGGTCAGG - Intronic
1195531952 X:105967869-105967891 CAAGGAAAGAAGGAATGGTGTGG - Intergenic
1196007791 X:110854014-110854036 CCTAGGAAGAAGGAAAGAAGTGG + Intergenic
1196220732 X:113110497-113110519 ACAGGGAAGAAGGAAATGTGGGG + Intergenic
1196792737 X:119479224-119479246 CCTGGTTAGAGGTAAGGGTGCGG - Intergenic
1196797090 X:119511074-119511096 CCTGGGAAGCAGCAAGGGGAAGG - Intergenic
1196911996 X:120493101-120493123 ACTTGGAAGGAGGAAGGGTTGGG - Intergenic
1198402007 X:136277675-136277697 CCTGGGTAGAGGGCAGGGTATGG + Intergenic
1199237432 X:145507360-145507382 CCTGGGAATCAGGAAGGCAGGGG - Intergenic
1199363703 X:146952487-146952509 CTTGGGAGGATGGCAGGGTGTGG + Intergenic
1199677347 X:150199549-150199571 CCAGGGAAGAAGGCAGAGTTGGG - Intergenic
1199719694 X:150533878-150533900 CCTGGCCAGAAGGCAGGGGGAGG + Intergenic
1201467507 Y:14299779-14299801 CTTGGAAATAAGGAAGTGTGAGG - Intergenic
1201581619 Y:15516309-15516331 ACAGGGAAGAAGGAAATGTGGGG - Intergenic
1201723341 Y:17128470-17128492 CCTGGGAAGAATGAGGACTGAGG + Intergenic
1202076235 Y:21040492-21040514 ACAGGGAAGAAGGAAATGTGGGG + Intergenic