ID: 1033660491

View in Genome Browser
Species Human (GRCh38)
Location 7:143398880-143398902
Sequence GACTCAGCTCTCCCTGCGTT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 111}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033660491_1033660503 15 Left 1033660491 7:143398880-143398902 CCCAACGCAGGGAGAGCTGAGTC 0: 1
1: 0
2: 1
3: 8
4: 111
Right 1033660503 7:143398918-143398940 CTCAGGTTTCGGGGGGCCGAGGG 0: 1
1: 0
2: 0
3: 9
4: 91
1033660491_1033660499 6 Left 1033660491 7:143398880-143398902 CCCAACGCAGGGAGAGCTGAGTC 0: 1
1: 0
2: 1
3: 8
4: 111
Right 1033660499 7:143398909-143398931 GCAGAGAAGCTCAGGTTTCGGGG 0: 1
1: 0
2: 2
3: 13
4: 143
1033660491_1033660505 17 Left 1033660491 7:143398880-143398902 CCCAACGCAGGGAGAGCTGAGTC 0: 1
1: 0
2: 1
3: 8
4: 111
Right 1033660505 7:143398920-143398942 CAGGTTTCGGGGGGCCGAGGGGG 0: 1
1: 0
2: 1
3: 35
4: 586
1033660491_1033660506 18 Left 1033660491 7:143398880-143398902 CCCAACGCAGGGAGAGCTGAGTC 0: 1
1: 0
2: 1
3: 8
4: 111
Right 1033660506 7:143398921-143398943 AGGTTTCGGGGGGCCGAGGGGGG 0: 1
1: 0
2: 0
3: 18
4: 439
1033660491_1033660508 27 Left 1033660491 7:143398880-143398902 CCCAACGCAGGGAGAGCTGAGTC 0: 1
1: 0
2: 1
3: 8
4: 111
Right 1033660508 7:143398930-143398952 GGGGCCGAGGGGGGACCTGTGGG 0: 1
1: 0
2: 4
3: 26
4: 262
1033660491_1033660494 -2 Left 1033660491 7:143398880-143398902 CCCAACGCAGGGAGAGCTGAGTC 0: 1
1: 0
2: 1
3: 8
4: 111
Right 1033660494 7:143398901-143398923 TCCCTGAGGCAGAGAAGCTCAGG 0: 1
1: 0
2: 1
3: 30
4: 450
1033660491_1033660507 26 Left 1033660491 7:143398880-143398902 CCCAACGCAGGGAGAGCTGAGTC 0: 1
1: 0
2: 1
3: 8
4: 111
Right 1033660507 7:143398929-143398951 GGGGGCCGAGGGGGGACCTGTGG 0: 1
1: 0
2: 1
3: 66
4: 664
1033660491_1033660500 7 Left 1033660491 7:143398880-143398902 CCCAACGCAGGGAGAGCTGAGTC 0: 1
1: 0
2: 1
3: 8
4: 111
Right 1033660500 7:143398910-143398932 CAGAGAAGCTCAGGTTTCGGGGG 0: 1
1: 0
2: 0
3: 10
4: 141
1033660491_1033660504 16 Left 1033660491 7:143398880-143398902 CCCAACGCAGGGAGAGCTGAGTC 0: 1
1: 0
2: 1
3: 8
4: 111
Right 1033660504 7:143398919-143398941 TCAGGTTTCGGGGGGCCGAGGGG 0: 1
1: 0
2: 0
3: 5
4: 94
1033660491_1033660498 5 Left 1033660491 7:143398880-143398902 CCCAACGCAGGGAGAGCTGAGTC 0: 1
1: 0
2: 1
3: 8
4: 111
Right 1033660498 7:143398908-143398930 GGCAGAGAAGCTCAGGTTTCGGG 0: 1
1: 0
2: 4
3: 20
4: 265
1033660491_1033660502 14 Left 1033660491 7:143398880-143398902 CCCAACGCAGGGAGAGCTGAGTC 0: 1
1: 0
2: 1
3: 8
4: 111
Right 1033660502 7:143398917-143398939 GCTCAGGTTTCGGGGGGCCGAGG 0: 1
1: 0
2: 0
3: 12
4: 162
1033660491_1033660497 4 Left 1033660491 7:143398880-143398902 CCCAACGCAGGGAGAGCTGAGTC 0: 1
1: 0
2: 1
3: 8
4: 111
Right 1033660497 7:143398907-143398929 AGGCAGAGAAGCTCAGGTTTCGG 0: 1
1: 0
2: 1
3: 31
4: 322
1033660491_1033660501 8 Left 1033660491 7:143398880-143398902 CCCAACGCAGGGAGAGCTGAGTC 0: 1
1: 0
2: 1
3: 8
4: 111
Right 1033660501 7:143398911-143398933 AGAGAAGCTCAGGTTTCGGGGGG 0: 1
1: 0
2: 1
3: 18
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033660491 Original CRISPR GACTCAGCTCTCCCTGCGTT GGG (reversed) Exonic
900551377 1:3257905-3257927 GACACAGCTGTCCCTGTGGTGGG - Intronic
900620081 1:3582705-3582727 GACTCAGCTCTCCCTGCTTGGGG + Intronic
903031100 1:20464950-20464972 GATTCAGTTCTCACTGGGTTGGG - Intergenic
904891989 1:33786288-33786310 GAATCATTTCTCCCTGCTTTTGG + Intronic
905808968 1:40898313-40898335 CACTCAGTTGCCCCTGCGTTTGG - Intergenic
906107911 1:43305708-43305730 GACTCTGCCCTGCCTGTGTTGGG - Intronic
906383298 1:45346441-45346463 GACCCATCACTCCTTGCGTTAGG - Intronic
907889213 1:58621692-58621714 TACTCACCTCTCTCTGCTTTAGG + Intergenic
912535298 1:110364048-110364070 GAATCAGCTCCACCTGAGTTAGG + Intronic
913971586 1:143421576-143421598 GACTGAGCTCTCCCTGGCTAGGG + Intergenic
914065963 1:144247189-144247211 GACTGAGCTCTCCCTGGCTAGGG + Intergenic
914113188 1:144719165-144719187 GACTGAGCTCTCCCTGGCTAGGG - Intergenic
922586524 1:226738008-226738030 GACTCAGCTCTCCCGGGCTGAGG + Intronic
1063120208 10:3100572-3100594 GGCGAAGCTCTCCCTGCCTTCGG - Intronic
1066653843 10:37681845-37681867 GCCTCAGCTCCCACTGGGTTCGG + Intergenic
1069610286 10:69768232-69768254 GACTCAGTTCTGCCTTCGTTGGG - Intergenic
1070976854 10:80612377-80612399 GACTCGGCTCTCCCTGGGCTTGG + Intronic
1077308288 11:1877451-1877473 GACTGAGCTCTCCCTGGCTAGGG - Intronic
1081289967 11:41312741-41312763 GCCTCAGCTCTCCCAAAGTTGGG + Intronic
1083333154 11:61908347-61908369 GACTCAGCTCTCCAGGCCTCAGG - Intronic
1083374074 11:62205508-62205530 GACTGACCTCCCCCTGCGTAGGG - Intergenic
1084899256 11:72297483-72297505 CACTCTGCTGTCCCTGCCTTGGG + Intronic
1085709142 11:78813477-78813499 GACTCAGCGCTCCCAGGATTGGG + Intronic
1089496783 11:118912040-118912062 GACTCAGCTCGCCCTGCGGCGGG - Intronic
1092743871 12:11654996-11655018 GACTTAGCTCTACCTGCCTCTGG - Intronic
1097195233 12:57239291-57239313 GACCCTGCACTCCCGGCGTTCGG + Intronic
1099307327 12:80973771-80973793 GACTCAAATCTTCCTGCATTAGG + Intronic
1101749166 12:107569028-107569050 GACTCACATCACCCTGCATTTGG - Intronic
1104988015 12:132608238-132608260 GGCTCAGCTGCCCCTGCGATGGG - Intronic
1106766249 13:32916734-32916756 GACTCAGTTCTCCCTGGGGGAGG - Intergenic
1108555161 13:51584505-51584527 GACTCCGCGCTCCCTGCTTCAGG - Exonic
1114535659 14:23420706-23420728 GTCTCAGCTCTGCCTTAGTTGGG - Intronic
1115487472 14:33925910-33925932 GATTCAGTTTTCCCTGGGTTGGG + Exonic
1119277056 14:73367467-73367489 GACACAGCTCTTCCTGTTTTGGG - Intronic
1121318102 14:92974143-92974165 GACTCATCTCTCCCTGAAGTTGG + Intronic
1121929587 14:97960281-97960303 CCCTCAGCTCCCCCTGCATTTGG - Intronic
1125006727 15:34824980-34825002 GACTCAGCTCTCTCCATGTTGGG + Intergenic
1126069170 15:44850757-44850779 GAGTCAGCTCTTCCTCAGTTAGG - Intergenic
1126089641 15:45040016-45040038 GAGTCAGCTCTTCCTCAGTTAGG + Intronic
1126518067 15:49557673-49557695 CACTCACCTTTCCCTGCGTGAGG - Intronic
1129266415 15:74395801-74395823 GACTCAGCTCTGCCTCTGTGAGG - Intergenic
1129717113 15:77858930-77858952 GGCTGGGCTCTCCCTGCATTGGG - Intergenic
1130584532 15:85170805-85170827 GACTCAGCTCTCTCAGCCTGTGG + Intergenic
1130584543 15:85170916-85170938 GACTCAGCTCTCTCAGCCTGTGG + Intergenic
1131713978 15:95088347-95088369 GAATCAGCTGTCCCTGGGATCGG - Intergenic
1137660721 16:50203841-50203863 GACTCAACTCTTCCTGCTTCGGG - Intronic
1137733065 16:50703739-50703761 CACTTAGCTTTCCCTGCCTTGGG - Intronic
1138292202 16:55857198-55857220 GACTCAACTCTTCCTGCCTCAGG + Intronic
1144055922 17:11540438-11540460 TACACAGTTCTCCCTGCCTTTGG + Intronic
1144135144 17:12288266-12288288 GTCTCAGCTCTCTGTGCTTTAGG - Intergenic
1145201019 17:20944759-20944781 CACTGAGCTCTCCCTGCCCTGGG + Intergenic
1147663468 17:42130024-42130046 GAGTCAGCTCTCCCTCCATGAGG + Intronic
1152008797 17:77698112-77698134 GACGCAGATCACCCTGCGTGAGG + Intergenic
1152099409 17:78292264-78292286 CACTCGGCTTTCCCTGCGTGGGG + Intergenic
1153604023 18:6813133-6813155 TACTCAGCTTTCCCTGTGGTAGG - Intronic
1153630173 18:7061924-7061946 GAGTCAGCTGTCCCCGAGTTAGG + Intronic
1161315053 19:3613799-3613821 GACCCACCTCTCCCTGCCATGGG - Intronic
1161453876 19:4360842-4360864 GACACAGGCCTCCCTGGGTTGGG + Exonic
1167429694 19:49447341-49447363 GACTCAGCTCTCCCGGGGGCGGG + Exonic
926868054 2:17381292-17381314 TTCTCAGCTCTCCCAGCCTTAGG - Intergenic
934176282 2:89582509-89582531 GACTGAGCTCTCCCTGGCTAGGG + Intergenic
934286592 2:91656870-91656892 GACTGAGCTCTCCCTGGCTAGGG + Intergenic
935102075 2:100006625-100006647 GACTCACCTCCCCCTGCTTGGGG + Exonic
937284739 2:120743172-120743194 GACTGAACTCTCTCTGCTTTGGG + Intronic
941661913 2:168203882-168203904 GACTCAGCTCTGGCTGGGTGCGG - Intronic
947518934 2:230829146-230829168 GACTCAGCTCTTCCTGGCTTGGG + Intergenic
1173262521 20:41449392-41449414 GAAACAGCTCTCCCTGTCTTAGG - Intronic
1175744137 20:61442214-61442236 GAGCCAGCTTGCCCTGCGTTTGG - Intronic
1177480343 21:21678285-21678307 GACTCAGCCATCCCTGTATTGGG - Intergenic
1180217602 21:46335638-46335660 GACTCAGTTCACACTGCTTTAGG + Intronic
1180998604 22:19977583-19977605 CACTCACCTCTCCCTGCAGTCGG - Exonic
1181365884 22:22376875-22376897 GACTCTGCTCTTCCAGCGTACGG + Intergenic
1181372320 22:22428397-22428419 GACTCTGCTCTTCCAGCGTACGG + Intergenic
1183387749 22:37524921-37524943 TGCTCTGCTCTCCCTGCCTTGGG - Intergenic
1185052516 22:48561290-48561312 GACTCGGCTATCCCTGCGGACGG - Intronic
949533431 3:4978647-4978669 GCCTCAGCTGCCCCTGCGCTTGG + Intergenic
950640528 3:14345516-14345538 GACTCAGCTGGCTCTGGGTTGGG + Intergenic
956350506 3:68330021-68330043 GACCCAGCTATCCCTGCAATTGG - Intronic
960685174 3:120287850-120287872 GACTTAGCTCTTCCAGCCTTTGG + Intergenic
960901352 3:122557452-122557474 TACTCAGATCTCCCTGCGATTGG + Intronic
962646034 3:137441202-137441224 GAGTTTGCTCTCCCTGGGTTAGG - Intergenic
962722443 3:138188005-138188027 CACTCAGCTCTCCCGGGCTTTGG + Intronic
963781821 3:149494113-149494135 GACCCCTCTCTCCCTGGGTTTGG + Intronic
964838337 3:160965753-160965775 GATTCAGCTCTCCCAGTTTTAGG + Intronic
969568198 4:7992614-7992636 CACTGAGCTCTCCCTGGGGTCGG + Intronic
971788106 4:31131091-31131113 GTCTCAGTGCTCCCTGTGTTGGG - Intronic
972585621 4:40434964-40434986 GACTGAGCTTTCCATGTGTTTGG + Intronic
973713743 4:53654704-53654726 GACTCAGGTCTCCATGCTGTAGG - Intronic
973714413 4:53661011-53661033 GTCCCAGCTGTCCCTGCTTTGGG + Intronic
995525399 5:113046821-113046843 GACTCACCTCCCCCAGCCTTGGG + Intronic
1000021944 5:157325758-157325780 GGCTGAGCTCTCCCTGTGGTGGG - Intronic
1002049993 5:176565285-176565307 GACTCAGGCCTCCCTCCTTTTGG - Intronic
1002192429 5:177485307-177485329 GGCTGAGCTCTCCCTGGGCTGGG + Intronic
1006824799 6:36926887-36926909 GACTCAGATGTGCCTCCGTTGGG + Intronic
1008770633 6:54974769-54974791 GGTTCTGCTCTCCCTGCATTAGG + Intergenic
1010960791 6:82143482-82143504 GACTCAGCTTTTCCTGGATTAGG - Intergenic
1011411992 6:87075484-87075506 GAATCAGCTCTCCCTGCAGTAGG - Intergenic
1017782220 6:157724375-157724397 GACTCAGGTCTCCCTGGGCCTGG - Intronic
1017913656 6:158816524-158816546 CACTCAGCTCTGCCTGAGTAAGG + Intronic
1018956735 6:168415484-168415506 GACTCACTTCTCCCTGAGGTAGG + Intergenic
1020213746 7:6173266-6173288 CACTCAGGTATCCATGCGTTTGG + Intronic
1022889383 7:34681181-34681203 GACCCAGCTCTCCCTCAGGTTGG - Intronic
1026331159 7:69353743-69353765 GACTCAGCTCTCCTAGCGAGTGG - Intergenic
1033660491 7:143398880-143398902 GACTCAGCTCTCCCTGCGTTGGG - Exonic
1035201896 7:157273045-157273067 GTCTCAGCTCTCCCTGAGCTGGG - Intergenic
1035207052 7:157300565-157300587 GACGCAGCTCTCCCTGGGAGAGG + Intergenic
1035367437 7:158358186-158358208 GTCTCAGGTCTCCCTGTGGTTGG - Intronic
1036398379 8:8386988-8387010 GCCTCAGCTCTCCCTACCTCTGG + Intergenic
1036426556 8:8650099-8650121 GACACAGCTCTCCTTGTGTTTGG - Intergenic
1037521232 8:19682271-19682293 GTCTCTCCTCTCCCTGCTTTGGG + Intronic
1038683611 8:29694476-29694498 GGCTCAGGCCTCCCTGGGTTGGG + Intergenic
1047289466 8:123516752-123516774 GCCTCATCTCTCCCTGCATGTGG - Intronic
1049687314 8:143944133-143944155 GGCTCAGCTGTCCCTGCGCAGGG + Intronic
1050244311 9:3672005-3672027 CACACAGCTATCCCTGTGTTAGG + Intergenic
1050744375 9:8858669-8858691 GGCCCAGCTCTCCCCGCGTCCGG - Intronic
1055809461 9:80135264-80135286 GACTCTGCTATCCCTGCCTCTGG + Intergenic
1059074026 9:111170671-111170693 GACTCTGCTATCTCTGCATTTGG - Intergenic
1059565403 9:115379545-115379567 GACTCAGGCCTCCCTGCTCTAGG + Intronic
1187572054 X:20514788-20514810 GACTCAACTCTCCCTGAATGAGG + Intergenic
1191159373 X:57311824-57311846 GACTCAGTTCTGCCTGTGCTAGG - Intronic
1194212117 X:91082241-91082263 GACTGGCCTCTCCCTGCTTTTGG + Intergenic