ID: 1033663024

View in Genome Browser
Species Human (GRCh38)
Location 7:143416180-143416202
Sequence TGTACTGGTTGGAGCTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033663015_1033663024 17 Left 1033663015 7:143416140-143416162 CCCCCGGGAGCACAGCGATAGCT No data
Right 1033663024 7:143416180-143416202 TGTACTGGTTGGAGCTCAGGAGG No data
1033663021_1033663024 -10 Left 1033663021 7:143416167-143416189 CCTTGTCAAAAAGTGTACTGGTT No data
Right 1033663024 7:143416180-143416202 TGTACTGGTTGGAGCTCAGGAGG No data
1033663017_1033663024 15 Left 1033663017 7:143416142-143416164 CCCGGGAGCACAGCGATAGCTTG No data
Right 1033663024 7:143416180-143416202 TGTACTGGTTGGAGCTCAGGAGG No data
1033663018_1033663024 14 Left 1033663018 7:143416143-143416165 CCGGGAGCACAGCGATAGCTTGG No data
Right 1033663024 7:143416180-143416202 TGTACTGGTTGGAGCTCAGGAGG No data
1033663016_1033663024 16 Left 1033663016 7:143416141-143416163 CCCCGGGAGCACAGCGATAGCTT No data
Right 1033663024 7:143416180-143416202 TGTACTGGTTGGAGCTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033663024 Original CRISPR TGTACTGGTTGGAGCTCAGG AGG Intergenic
No off target data available for this crispr