ID: 1033663500

View in Genome Browser
Species Human (GRCh38)
Location 7:143420066-143420088
Sequence GGCCAGACCTTCAGGGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033663500_1033663507 8 Left 1033663500 7:143420066-143420088 CCGTCCTCCCTGAAGGTCTGGCC No data
Right 1033663507 7:143420097-143420119 AAAGGTTGTATTTGTTCAGAAGG No data
1033663500_1033663504 -10 Left 1033663500 7:143420066-143420088 CCGTCCTCCCTGAAGGTCTGGCC No data
Right 1033663504 7:143420079-143420101 AGGTCTGGCCTTCTGCCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033663500 Original CRISPR GGCCAGACCTTCAGGGAGGA CGG (reversed) Intergenic
No off target data available for this crispr