ID: 1033663504

View in Genome Browser
Species Human (GRCh38)
Location 7:143420079-143420101
Sequence AGGTCTGGCCTTCTGCCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033663493_1033663504 22 Left 1033663493 7:143420034-143420056 CCAGTTCTCTCCAGCAGCACCGA No data
Right 1033663504 7:143420079-143420101 AGGTCTGGCCTTCTGCCAAAAGG No data
1033663494_1033663504 12 Left 1033663494 7:143420044-143420066 CCAGCAGCACCGACACCTTCCGC No data
Right 1033663504 7:143420079-143420101 AGGTCTGGCCTTCTGCCAAAAGG No data
1033663496_1033663504 -3 Left 1033663496 7:143420059-143420081 CCTTCCGCCGTCCTCCCTGAAGG No data
Right 1033663504 7:143420079-143420101 AGGTCTGGCCTTCTGCCAAAAGG No data
1033663495_1033663504 3 Left 1033663495 7:143420053-143420075 CCGACACCTTCCGCCGTCCTCCC No data
Right 1033663504 7:143420079-143420101 AGGTCTGGCCTTCTGCCAAAAGG No data
1033663500_1033663504 -10 Left 1033663500 7:143420066-143420088 CCGTCCTCCCTGAAGGTCTGGCC No data
Right 1033663504 7:143420079-143420101 AGGTCTGGCCTTCTGCCAAAAGG No data
1033663498_1033663504 -7 Left 1033663498 7:143420063-143420085 CCGCCGTCCTCCCTGAAGGTCTG No data
Right 1033663504 7:143420079-143420101 AGGTCTGGCCTTCTGCCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033663504 Original CRISPR AGGTCTGGCCTTCTGCCAAA AGG Intergenic
No off target data available for this crispr