ID: 1033663507

View in Genome Browser
Species Human (GRCh38)
Location 7:143420097-143420119
Sequence AAAGGTTGTATTTGTTCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033663494_1033663507 30 Left 1033663494 7:143420044-143420066 CCAGCAGCACCGACACCTTCCGC No data
Right 1033663507 7:143420097-143420119 AAAGGTTGTATTTGTTCAGAAGG No data
1033663503_1033663507 0 Left 1033663503 7:143420074-143420096 CCTGAAGGTCTGGCCTTCTGCCA No data
Right 1033663507 7:143420097-143420119 AAAGGTTGTATTTGTTCAGAAGG No data
1033663498_1033663507 11 Left 1033663498 7:143420063-143420085 CCGCCGTCCTCCCTGAAGGTCTG No data
Right 1033663507 7:143420097-143420119 AAAGGTTGTATTTGTTCAGAAGG No data
1033663502_1033663507 1 Left 1033663502 7:143420073-143420095 CCCTGAAGGTCTGGCCTTCTGCC No data
Right 1033663507 7:143420097-143420119 AAAGGTTGTATTTGTTCAGAAGG No data
1033663495_1033663507 21 Left 1033663495 7:143420053-143420075 CCGACACCTTCCGCCGTCCTCCC No data
Right 1033663507 7:143420097-143420119 AAAGGTTGTATTTGTTCAGAAGG No data
1033663496_1033663507 15 Left 1033663496 7:143420059-143420081 CCTTCCGCCGTCCTCCCTGAAGG No data
Right 1033663507 7:143420097-143420119 AAAGGTTGTATTTGTTCAGAAGG No data
1033663501_1033663507 4 Left 1033663501 7:143420070-143420092 CCTCCCTGAAGGTCTGGCCTTCT No data
Right 1033663507 7:143420097-143420119 AAAGGTTGTATTTGTTCAGAAGG No data
1033663500_1033663507 8 Left 1033663500 7:143420066-143420088 CCGTCCTCCCTGAAGGTCTGGCC No data
Right 1033663507 7:143420097-143420119 AAAGGTTGTATTTGTTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033663507 Original CRISPR AAAGGTTGTATTTGTTCAGA AGG Intergenic
No off target data available for this crispr