ID: 1033669104

View in Genome Browser
Species Human (GRCh38)
Location 7:143472697-143472719
Sequence CCCAGCGGGTACTCCGAGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033669104_1033669110 -9 Left 1033669104 7:143472697-143472719 CCGGACTCGGAGTACCCGCTGGG No data
Right 1033669110 7:143472711-143472733 CCCGCTGGGTAGTGTGGGGCTGG No data
1033669104_1033669115 30 Left 1033669104 7:143472697-143472719 CCGGACTCGGAGTACCCGCTGGG No data
Right 1033669115 7:143472750-143472772 TCAAGCAGAAATCTGCAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033669104 Original CRISPR CCCAGCGGGTACTCCGAGTC CGG (reversed) Intergenic
No off target data available for this crispr