ID: 1033674014

View in Genome Browser
Species Human (GRCh38)
Location 7:143519932-143519954
Sequence CTGGTCCAGCATGCGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033674014_1033674026 12 Left 1033674014 7:143519932-143519954 CCCACCTCCGCATGCTGGACCAG No data
Right 1033674026 7:143519967-143519989 AGATCCCATGGTGAAGCATCAGG No data
1033674014_1033674021 0 Left 1033674014 7:143519932-143519954 CCCACCTCCGCATGCTGGACCAG No data
Right 1033674021 7:143519955-143519977 GCGGCCCCCTCTAGATCCCATGG No data
1033674014_1033674029 22 Left 1033674014 7:143519932-143519954 CCCACCTCCGCATGCTGGACCAG No data
Right 1033674029 7:143519977-143519999 GTGAAGCATCAGGTGCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033674014 Original CRISPR CTGGTCCAGCATGCGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr