ID: 1033679675

View in Genome Browser
Species Human (GRCh38)
Location 7:143582169-143582191
Sequence CAGAGAAATGAACATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033679675_1033679681 26 Left 1033679675 7:143582169-143582191 CCCTCCTCATGTTCATTTCTCTG No data
Right 1033679681 7:143582218-143582240 GTGAATGGCTGTGATTGAACTGG No data
1033679675_1033679678 -8 Left 1033679675 7:143582169-143582191 CCCTCCTCATGTTCATTTCTCTG No data
Right 1033679678 7:143582184-143582206 TTTCTCTGAAAAATACCACTTGG No data
1033679675_1033679680 11 Left 1033679675 7:143582169-143582191 CCCTCCTCATGTTCATTTCTCTG No data
Right 1033679680 7:143582203-143582225 TTGGTACTAGATGATGTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033679675 Original CRISPR CAGAGAAATGAACATGAGGA GGG (reversed) Intergenic
No off target data available for this crispr