ID: 1033679675 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:143582169-143582191 |
| Sequence | CAGAGAAATGAACATGAGGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1033679675_1033679681 | 26 | Left | 1033679675 | 7:143582169-143582191 | CCCTCCTCATGTTCATTTCTCTG | No data | ||
| Right | 1033679681 | 7:143582218-143582240 | GTGAATGGCTGTGATTGAACTGG | No data | ||||
| 1033679675_1033679678 | -8 | Left | 1033679675 | 7:143582169-143582191 | CCCTCCTCATGTTCATTTCTCTG | No data | ||
| Right | 1033679678 | 7:143582184-143582206 | TTTCTCTGAAAAATACCACTTGG | No data | ||||
| 1033679675_1033679680 | 11 | Left | 1033679675 | 7:143582169-143582191 | CCCTCCTCATGTTCATTTCTCTG | No data | ||
| Right | 1033679680 | 7:143582203-143582225 | TTGGTACTAGATGATGTGAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1033679675 | Original CRISPR | CAGAGAAATGAACATGAGGA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||