ID: 1033679676

View in Genome Browser
Species Human (GRCh38)
Location 7:143582170-143582192
Sequence TCAGAGAAATGAACATGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033679676_1033679681 25 Left 1033679676 7:143582170-143582192 CCTCCTCATGTTCATTTCTCTGA No data
Right 1033679681 7:143582218-143582240 GTGAATGGCTGTGATTGAACTGG No data
1033679676_1033679680 10 Left 1033679676 7:143582170-143582192 CCTCCTCATGTTCATTTCTCTGA No data
Right 1033679680 7:143582203-143582225 TTGGTACTAGATGATGTGAATGG No data
1033679676_1033679678 -9 Left 1033679676 7:143582170-143582192 CCTCCTCATGTTCATTTCTCTGA No data
Right 1033679678 7:143582184-143582206 TTTCTCTGAAAAATACCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033679676 Original CRISPR TCAGAGAAATGAACATGAGG AGG (reversed) Intergenic
No off target data available for this crispr