ID: 1033679677

View in Genome Browser
Species Human (GRCh38)
Location 7:143582173-143582195
Sequence TTTTCAGAGAAATGAACATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033679677_1033679680 7 Left 1033679677 7:143582173-143582195 CCTCATGTTCATTTCTCTGAAAA No data
Right 1033679680 7:143582203-143582225 TTGGTACTAGATGATGTGAATGG No data
1033679677_1033679681 22 Left 1033679677 7:143582173-143582195 CCTCATGTTCATTTCTCTGAAAA No data
Right 1033679681 7:143582218-143582240 GTGAATGGCTGTGATTGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033679677 Original CRISPR TTTTCAGAGAAATGAACATG AGG (reversed) Intergenic
No off target data available for this crispr