ID: 1033679678 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:143582184-143582206 |
| Sequence | TTTCTCTGAAAAATACCACT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1033679675_1033679678 | -8 | Left | 1033679675 | 7:143582169-143582191 | CCCTCCTCATGTTCATTTCTCTG | No data | ||
| Right | 1033679678 | 7:143582184-143582206 | TTTCTCTGAAAAATACCACTTGG | No data | ||||
| 1033679674_1033679678 | 7 | Left | 1033679674 | 7:143582154-143582176 | CCAGTCAAGGAGTTTCCCTCCTC | No data | ||
| Right | 1033679678 | 7:143582184-143582206 | TTTCTCTGAAAAATACCACTTGG | No data | ||||
| 1033679676_1033679678 | -9 | Left | 1033679676 | 7:143582170-143582192 | CCTCCTCATGTTCATTTCTCTGA | No data | ||
| Right | 1033679678 | 7:143582184-143582206 | TTTCTCTGAAAAATACCACTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1033679678 | Original CRISPR | TTTCTCTGAAAAATACCACT TGG | Intergenic | ||
| No off target data available for this crispr | |||||