ID: 1033679680

View in Genome Browser
Species Human (GRCh38)
Location 7:143582203-143582225
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033679674_1033679680 26 Left 1033679674 7:143582154-143582176 CCAGTCAAGGAGTTTCCCTCCTC No data
Right 1033679680 7:143582203-143582225 TTGGTACTAGATGATGTGAATGG No data
1033679677_1033679680 7 Left 1033679677 7:143582173-143582195 CCTCATGTTCATTTCTCTGAAAA No data
Right 1033679680 7:143582203-143582225 TTGGTACTAGATGATGTGAATGG No data
1033679675_1033679680 11 Left 1033679675 7:143582169-143582191 CCCTCCTCATGTTCATTTCTCTG No data
Right 1033679680 7:143582203-143582225 TTGGTACTAGATGATGTGAATGG No data
1033679676_1033679680 10 Left 1033679676 7:143582170-143582192 CCTCCTCATGTTCATTTCTCTGA No data
Right 1033679680 7:143582203-143582225 TTGGTACTAGATGATGTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033679680 Original CRISPR TTGGTACTAGATGATGTGAA TGG Intergenic
No off target data available for this crispr