ID: 1033679681

View in Genome Browser
Species Human (GRCh38)
Location 7:143582218-143582240
Sequence GTGAATGGCTGTGATTGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033679679_1033679681 -4 Left 1033679679 7:143582199-143582221 CCACTTGGTACTAGATGATGTGA No data
Right 1033679681 7:143582218-143582240 GTGAATGGCTGTGATTGAACTGG No data
1033679677_1033679681 22 Left 1033679677 7:143582173-143582195 CCTCATGTTCATTTCTCTGAAAA No data
Right 1033679681 7:143582218-143582240 GTGAATGGCTGTGATTGAACTGG No data
1033679675_1033679681 26 Left 1033679675 7:143582169-143582191 CCCTCCTCATGTTCATTTCTCTG No data
Right 1033679681 7:143582218-143582240 GTGAATGGCTGTGATTGAACTGG No data
1033679676_1033679681 25 Left 1033679676 7:143582170-143582192 CCTCCTCATGTTCATTTCTCTGA No data
Right 1033679681 7:143582218-143582240 GTGAATGGCTGTGATTGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033679681 Original CRISPR GTGAATGGCTGTGATTGAAC TGG Intergenic
No off target data available for this crispr