ID: 1033684666

View in Genome Browser
Species Human (GRCh38)
Location 7:143627379-143627401
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 3, 1: 0, 2: 0, 3: 3, 4: 69}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033684666 Original CRISPR AATCCCTTGGGGCAATTAAG AGG (reversed) Intronic
904452359 1:30621991-30622013 ACTCCCCTGGGGCTACTAAGGGG - Intergenic
909487488 1:76189864-76189886 AATCTCTGAGGGCCATTAAGTGG + Intronic
916003277 1:160636496-160636518 AATCCCTGGGTGCACTCAAGAGG + Intronic
920585413 1:207154612-207154634 AATCTCTTGGTGCATTTAGGAGG - Intergenic
1066291895 10:34022030-34022052 AATGCCCTGGGGCAAGTAAGTGG + Intergenic
1066352223 10:34646750-34646772 AATCACTTGGGGCAGGGAAGTGG - Intronic
1073515722 10:104074110-104074132 AATCCCTGGGGGAGATGAAGTGG - Intronic
1080485727 11:32704720-32704742 GATCCCTTTGGCCAATCAAGTGG + Intronic
1088743506 11:112785766-112785788 ATTCCACTGGAGCAATTAAGAGG - Intergenic
1090713045 11:129405103-129405125 AATCCCTTGGAGCATTAAAAGGG - Intronic
1093943229 12:25078644-25078666 AATTCCTTGTAGAAATTAAGAGG + Intronic
1109777755 13:67064814-67064836 AATCCCTTAGGGCATTCAAAGGG + Intronic
1113078402 13:106491413-106491435 ATTCATTTGTGGCAATTAAGTGG - Exonic
1116085256 14:40228800-40228822 AATCAGTTGGTGCAACTAAGTGG - Intergenic
1117428333 14:55624498-55624520 CATCCCTTGTGCCATTTAAGTGG + Intronic
1124247603 15:28084439-28084461 AATGAGTTGGGGCAAGTAAGAGG - Intronic
1131313389 15:91311073-91311095 AATATCTTGGGGGAATGAAGGGG - Intergenic
1131561774 15:93449953-93449975 TATCCCTTGGATCAGTTAAGTGG + Intergenic
1133915010 16:10101556-10101578 AATCCCTGGGGTCATTTAGGTGG + Intronic
1138472497 16:57249290-57249312 AATCCCAGGGGGCTGTTAAGAGG - Intronic
1144158934 17:12537955-12537977 AATCCCTTGGAGAAATTATTTGG - Intergenic
1144337516 17:14285017-14285039 AAACCCTTGGGATATTTAAGGGG + Intergenic
1155607021 18:27618190-27618212 AATCCCTTTAGGGATTTAAGGGG - Intergenic
1157333814 18:46722566-46722588 CCTGCCCTGGGGCAATTAAGCGG - Intronic
1164064001 19:21698432-21698454 AATCCATTGGGACAACTAACAGG + Intergenic
1167023858 19:46899969-46899991 AATGGCTTGGGGCAAGTAATTGG + Intergenic
927203402 2:20592285-20592307 AATCCCTTGAGGAAATCCAGGGG - Intronic
932738747 2:74275432-74275454 AGTCCCATGGGGCAATTACAGGG - Intronic
934606999 2:95703120-95703142 AAGCTCTTGGGGCAACTGAGGGG - Intergenic
935538137 2:104318311-104318333 AATTCCATGGGGCAATTGGGAGG + Intergenic
939858929 2:147394433-147394455 AATCCCTTTGTGCAAATAAAAGG - Intergenic
941084763 2:161104622-161104644 AATTCCTGTGGGCAATTATGTGG - Intergenic
942452333 2:176116210-176116232 GATCCCTTGGGGCTAAGAAGCGG - Intronic
942465806 2:176206392-176206414 GATCCCCTGGCACAATTAAGCGG - Intergenic
1179321958 21:40300686-40300708 GATCCAGTGGGGCAATTATGAGG + Intronic
1179380032 21:40889820-40889842 AATTCCATGGGGCATTTCAGAGG - Intergenic
950427838 3:12934284-12934306 ATTCACTTGGGGCCAGTAAGGGG - Intronic
965407508 3:168288364-168288386 TATCCCTAGGTGCTATTAAGAGG - Intergenic
966895928 3:184445034-184445056 CATCCCTTGGTGCAATTGGGAGG - Intronic
967734734 3:192940276-192940298 TTTCCCTCGGGGCAATTGAGAGG + Intergenic
969894850 4:10293984-10294006 AATCCCTTATGGAAAATAAGGGG + Intergenic
978971893 4:114818351-114818373 TATCCCTTGGGGCTATTGTGAGG - Intergenic
980233325 4:130071894-130071916 AGTCCCATGGGGCAATGTAGAGG + Intergenic
986164292 5:5260075-5260097 AATCCCTTGGGGCAACAGAAAGG - Intronic
996627091 5:125583537-125583559 AATCCCTTAGGCCAGTTAAAAGG + Intergenic
997581595 5:135020548-135020570 AAACCCTTGGTTCAATTAAATGG + Intergenic
997654666 5:135546046-135546068 AAGCACTTGGGGCAAGTTAGAGG - Intergenic
1001072667 5:168600463-168600485 AATCACTGGAGGTAATTAAGAGG - Intergenic
1003854104 6:10254585-10254607 TATCTCTTGGGGCAATAATGAGG - Intergenic
1007022710 6:38538305-38538327 ATTACTTTGGGGAAATTAAGGGG + Intronic
1007544646 6:42684247-42684269 AATCACTTGGGGGAATTTTGAGG - Intronic
1009888476 6:69653205-69653227 AAACTCTTGGGACAAGTAAGTGG + Intergenic
1018483031 6:164211311-164211333 AAGTCCTTTTGGCAATTAAGTGG + Intergenic
1021260361 7:18448961-18448983 AAGCTCTTGGGCCAATTAATAGG + Intronic
1028035979 7:85982758-85982780 AAAGCCTTGGGACAATTATGAGG + Intergenic
1028681546 7:93540017-93540039 ATTCCCTTGGGGGAATTGTGGGG + Intronic
1030909305 7:115226732-115226754 AGTACCTTGGGGGAATTGAGGGG - Intergenic
1031670715 7:124541460-124541482 AGTTCCTTGGGCTAATTAAGAGG - Intergenic
1031906386 7:127464628-127464650 AAACCCTTGGGGAAATTAAAGGG + Intergenic
1033684666 7:143627379-143627401 AATCCCTTGGGGCAATTAAGAGG - Intronic
1033687842 7:143706598-143706620 AATCCCTTGGGGCAATTAAGAGG - Intronic
1033699945 7:143830244-143830266 AATCCCTTGGGGCAATTAAGAGG + Intergenic
1036580483 8:10070130-10070152 AATACTTTGGGGAAAATAAGAGG + Intronic
1037041245 8:14237606-14237628 AATCACATGGGGCAGTTAACCGG - Exonic
1037303045 8:17473013-17473035 AATCCTGTGTAGCAATTAAGAGG - Intergenic
1047628230 8:126678427-126678449 AATCACTTGGGTGATTTAAGTGG + Intergenic
1050496749 9:6251000-6251022 AATCCCTTTGGACCATGAAGTGG + Intronic
1061767177 9:132888704-132888726 ATTCCCTTGGGGTTAGTAAGTGG - Intronic
1186781181 X:12913529-12913551 AATACCATGTGGCAATTAAACGG - Intronic
1186815366 X:13232070-13232092 AATCTTTTAGGGAAATTAAGGGG + Intergenic
1190439718 X:50465066-50465088 AATCTCTTGAGAAAATTAAGGGG - Intronic
1191937112 X:66437846-66437868 AGTCCCTTGGGGCGATTCTGTGG - Intergenic
1195432057 X:104800016-104800038 AAGCCATTGGGGGAATTAATTGG - Intronic
1198800394 X:140441919-140441941 AATCACTGAGGGCCATTAAGAGG + Intergenic
1202036870 Y:20645083-20645105 AATCACTTGGGGCAATTAGTTGG + Intergenic