ID: 1033685693

View in Genome Browser
Species Human (GRCh38)
Location 7:143639639-143639661
Sequence GCCTTTTCTCTCCCGCCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 3, 1: 0, 2: 5, 3: 18, 4: 246}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033685690_1033685693 4 Left 1033685690 7:143639612-143639634 CCATGGTGGAGTTGATGGCGTGA 0: 3
1: 0
2: 0
3: 6
4: 151
Right 1033685693 7:143639639-143639661 GCCTTTTCTCTCCCGCCTTGTGG 0: 3
1: 0
2: 5
3: 18
4: 246
1033685686_1033685693 12 Left 1033685686 7:143639604-143639626 CCAAAGCCCCATGGTGGAGTTGA 0: 3
1: 0
2: 0
3: 8
4: 119
Right 1033685693 7:143639639-143639661 GCCTTTTCTCTCCCGCCTTGTGG 0: 3
1: 0
2: 5
3: 18
4: 246
1033685689_1033685693 5 Left 1033685689 7:143639611-143639633 CCCATGGTGGAGTTGATGGCGTG 0: 3
1: 0
2: 0
3: 13
4: 109
Right 1033685693 7:143639639-143639661 GCCTTTTCTCTCCCGCCTTGTGG 0: 3
1: 0
2: 5
3: 18
4: 246
1033685688_1033685693 6 Left 1033685688 7:143639610-143639632 CCCCATGGTGGAGTTGATGGCGT No data
Right 1033685693 7:143639639-143639661 GCCTTTTCTCTCCCGCCTTGTGG 0: 3
1: 0
2: 5
3: 18
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033685693 Original CRISPR GCCTTTTCTCTCCCGCCTTG TGG Intronic