ID: 1033685693

View in Genome Browser
Species Human (GRCh38)
Location 7:143639639-143639661
Sequence GCCTTTTCTCTCCCGCCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 3, 1: 0, 2: 5, 3: 18, 4: 246}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033685686_1033685693 12 Left 1033685686 7:143639604-143639626 CCAAAGCCCCATGGTGGAGTTGA 0: 3
1: 0
2: 0
3: 8
4: 119
Right 1033685693 7:143639639-143639661 GCCTTTTCTCTCCCGCCTTGTGG 0: 3
1: 0
2: 5
3: 18
4: 246
1033685690_1033685693 4 Left 1033685690 7:143639612-143639634 CCATGGTGGAGTTGATGGCGTGA 0: 3
1: 0
2: 0
3: 6
4: 151
Right 1033685693 7:143639639-143639661 GCCTTTTCTCTCCCGCCTTGTGG 0: 3
1: 0
2: 5
3: 18
4: 246
1033685689_1033685693 5 Left 1033685689 7:143639611-143639633 CCCATGGTGGAGTTGATGGCGTG 0: 3
1: 0
2: 0
3: 13
4: 109
Right 1033685693 7:143639639-143639661 GCCTTTTCTCTCCCGCCTTGTGG 0: 3
1: 0
2: 5
3: 18
4: 246
1033685688_1033685693 6 Left 1033685688 7:143639610-143639632 CCCCATGGTGGAGTTGATGGCGT 0: 3
1: 0
2: 0
3: 7
4: 61
Right 1033685693 7:143639639-143639661 GCCTTTTCTCTCCCGCCTTGTGG 0: 3
1: 0
2: 5
3: 18
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033685693 Original CRISPR GCCTTTTCTCTCCCGCCTTG TGG Intronic
902899917 1:19507742-19507764 CCCTCTTCTCTCATGCCTTGGGG + Intergenic
903919868 1:26792191-26792213 GCCTTTGCACTCCAGCCTGGGGG - Intronic
905403192 1:37717529-37717551 AGCTTTTCTCTCCAGCCATGGGG - Exonic
905620311 1:39439644-39439666 GCCATTGCACTCCAGCCTTGGGG - Intronic
905703955 1:40040516-40040538 CCCGTGTCGCTCCCGCCTTGAGG + Exonic
906781782 1:48579266-48579288 GCCATTGCACTCCAGCCTTGGGG - Intronic
906795279 1:48691922-48691944 ACCTTCTCTCACCCTCCTTGTGG + Intronic
906821970 1:48939516-48939538 GCCTTTCCTCCCCCTCCTGGAGG - Intronic
908085855 1:60633116-60633138 GGCCTTTCTCCCCAGCCTTGTGG - Intergenic
908513922 1:64873202-64873224 GCCTTTTTTCTCCTCACTTGGGG + Intronic
908787530 1:67749828-67749850 TTCATTTCTCTCCAGCCTTGAGG - Intronic
909482433 1:76140468-76140490 GCCTTTTGTCTTCCTCTTTGTGG + Intronic
910278181 1:85470287-85470309 TCATTTTCTCTCTTGCCTTGTGG - Intronic
912757223 1:112334431-112334453 GCCTCTCCTCTCCATCCTTGAGG + Intergenic
914235480 1:145806664-145806686 CCCCTTTCTCTCTTGCCTTGCGG + Intronic
914252301 1:145931658-145931680 GCCATTTCACTCCAGCCTGGGGG + Intergenic
915513070 1:156397354-156397376 GCCTTTGCCCTCCAGCCTGGGGG - Intergenic
922581820 1:226703718-226703740 CCCTTGTCTTTCCCGCCTGGGGG - Intronic
1063091240 10:2867684-2867706 TCCTTGTCTTTCCCGCCTTCTGG - Intergenic
1063437834 10:6048903-6048925 GCCTGAGCTCTCCTGCCTTGCGG + Intronic
1068689173 10:59898564-59898586 AGCCTTTCTCTCCAGCCTTGGGG - Intronic
1068813726 10:61285990-61286012 GCCTTCTCTCTCACTCCCTGTGG - Intergenic
1074772488 10:116742769-116742791 GCCTCTCCTCTCCCGGCTTCGGG + Intergenic
1075908600 10:126104407-126104429 GCCATTGCACTCCAGCCTTGGGG + Intronic
1076637802 10:131893771-131893793 GCCTTTCTTCTCCGGCCTGGGGG - Intergenic
1077482527 11:2822639-2822661 GCCTATTCCTTCCTGCCTTGGGG - Intronic
1079010933 11:16827623-16827645 CCCTTCTCTCTGCCTCCTTGGGG + Intronic
1079233374 11:18669103-18669125 GCCATTGCTCTCCAGCCTGGAGG + Intergenic
1081726894 11:45336438-45336460 GCCATTTCTATCCCTCCTTGAGG + Intergenic
1081997089 11:47372706-47372728 GCTTTGTCCCTCCTGCCTTGAGG + Intronic
1084804788 11:71571429-71571451 GACTTTTCTTTCCCGCGTGGAGG - Intergenic
1084805667 11:71577094-71577116 GACTTTTCTTTCCCGCGTGGAGG + Intergenic
1085595555 11:77806013-77806035 GCCTTTTCTCTCACTCCCTATGG + Intronic
1088659672 11:112033021-112033043 GCCATTGCTCTCCAGCCTGGGGG + Intronic
1090387854 11:126366939-126366961 GCCTTTGCTGTCCCTGCTTGGGG + Intronic
1090390499 11:126384408-126384430 GCCTTTGCTGTCCCTGCTTGGGG + Intronic
1093611126 12:21158651-21158673 GCCATTGCACTCCAGCCTTGGGG + Intronic
1093667534 12:21832281-21832303 GCTTTTCCTCCCCCGCATTGAGG - Intronic
1097697190 12:62786322-62786344 TCCTTTCCTCTCCCGCCTCAGGG - Intronic
1099098865 12:78411512-78411534 CCCTTTTCTCTGCAACCTTGCGG + Intergenic
1100117435 12:91324633-91324655 GCCATTGCACTCCAGCCTTGGGG - Intergenic
1100731479 12:97475375-97475397 ACCTTTTCTTTCTCACCTTGGGG + Intergenic
1101989350 12:109471701-109471723 GCCTTTTCTCCCCCCCTTCGAGG - Intronic
1102461103 12:113100066-113100088 GCCTCTTGTCTCCCTCCTAGGGG - Exonic
1102671569 12:114623799-114623821 GCCTTTTGCCTCCAGCATTGAGG + Intergenic
1103390910 12:120572634-120572656 GCCATTGCACTCCAGCCTTGGGG - Intronic
1103600406 12:122051035-122051057 GCCTTGTTTCTCCCACGTTGGGG + Intronic
1105520556 13:21127206-21127228 GCCATTTCACTCCAGCCTGGGGG - Intergenic
1107103044 13:36614579-36614601 GCTATTTCTCTCCATCCTTGAGG + Intergenic
1107555885 13:41516396-41516418 GCCTTTTCAGCCCCACCTTGAGG - Intergenic
1109736167 13:66486593-66486615 GCCATTGCTCTCCAGCCTGGAGG + Intronic
1111309022 13:86457115-86457137 GCCTTTACACTCCAGCCTGGGGG - Intergenic
1111529220 13:89515158-89515180 GCCTCTTCTCTCAGGCCTTTGGG - Intergenic
1111820210 13:93204725-93204747 GCCACTTCTCTCCAGCCTGGGGG - Intergenic
1114049612 14:18912670-18912692 TCCTTTTCTCTCCTGCCTTGGGG - Intergenic
1114112950 14:19489261-19489283 TCCTTTTCTCTCCTGCCTTGGGG + Intergenic
1115535064 14:34364972-34364994 GCCATTGCACTCCCGCGTTGGGG + Intronic
1116018195 14:39431839-39431861 GCCTCTTCTATCCGGCCCTGTGG - Exonic
1116254811 14:42538549-42538571 ACCTTTCATCTCCCGACTTGTGG + Intergenic
1116584139 14:46680428-46680450 GCCATTGCACTCCAGCCTTGGGG + Intergenic
1116701829 14:48254387-48254409 GCCTTTTTTCTCCCTCCTGCTGG - Intergenic
1119393232 14:74305674-74305696 GCCATTGCGCTCCAGCCTTGGGG - Intronic
1119780005 14:77271089-77271111 GCCTTTTCTCTCCCGCGCCAGGG - Exonic
1119999780 14:79289796-79289818 GCCATTTCTTTCCTGCCTTCTGG - Intronic
1120706745 14:87753396-87753418 GCCATTGCACTCCAGCCTTGGGG + Intergenic
1121067607 14:90983234-90983256 GCCATTTCACTCCAGCCTGGGGG + Intronic
1121653776 14:95579754-95579776 GCCACTGCTCTCCAGCCTTGGGG + Intergenic
1125452979 15:39828185-39828207 GCATTTTCTCTCCCACCTCTGGG - Intronic
1129461371 15:75701632-75701654 TCCTTTTCTCTCCCGGCCTCAGG + Intronic
1129723463 15:77890175-77890197 TCCTTTTCTCTCCCGGCCTCAGG - Intergenic
1131024108 15:89125046-89125068 GCCATTGCACTCCAGCCTTGGGG + Intronic
1131270736 15:90946211-90946233 GCCATTGCACTCCAGCCTTGGGG + Intronic
1133970145 16:10561527-10561549 GTCTTTTCTCTCCTGGCTTCTGG - Intronic
1134140036 16:11710499-11710521 GCCTTTTCTCACTGGCCTTCAGG - Intronic
1138331167 16:56216568-56216590 GTCTTGTCTCTGCCACCTTGGGG + Intronic
1139559153 16:67730615-67730637 GCCTTTTCGCTCTTGCCGTGGGG + Intronic
1140263453 16:73400394-73400416 TCCTTTTCATTCCCGTCTTGTGG - Intergenic
1141890087 16:86920485-86920507 GCCCTTGGCCTCCCGCCTTGAGG + Intergenic
1142191595 16:88720680-88720702 GCCTCTTCTCTCTCCCCGTGGGG + Exonic
1144461996 17:15466020-15466042 TCCCTTTCTCTCCCTCCTTCAGG - Intronic
1144707842 17:17381096-17381118 GCCTTTTCTCACACGCATAGGGG - Intergenic
1144916700 17:18729434-18729456 GCCATTGCACTCCGGCCTTGGGG - Intronic
1145064676 17:19754032-19754054 GCCGTTTCCCTGCCGCCTAGTGG + Intergenic
1146631073 17:34469723-34469745 GCATGTTCTCTCCTGCCTTCTGG + Intergenic
1148911053 17:50943107-50943129 GCCATTGCTCTCCAGCCTGGGGG - Intergenic
1149935715 17:60804438-60804460 GCCATTGCACTCCAGCCTTGGGG + Intronic
1150899186 17:69252050-69252072 GCCACTTCTCTCCAGCCTGGGGG - Intronic
1150938415 17:69662672-69662694 GCCTTTGCACTCCAGCCTGGGGG - Intergenic
1151242153 17:72766528-72766550 TCCTTCTCCCTCCAGCCTTGGGG + Intronic
1151829659 17:76542197-76542219 GCCTTTTCTCTCCTGCCAGGAGG - Intronic
1154964786 18:21345829-21345851 GCCATTGCACTCCAGCCTTGGGG + Intronic
1155249141 18:23938816-23938838 CCCCTTTCTCTCCCTCCTTTGGG - Intronic
1156098261 18:33562238-33562260 TCCTTTTCTCTCCCTTGTTGGGG - Intergenic
1160148205 18:76380931-76380953 GCCTTTGCTCACCCGCCTCTGGG - Intronic
1160631821 18:80251996-80252018 GCCTTTTGTCTTCCACCTGGGGG - Intergenic
1161003351 19:1922298-1922320 GCCGTTGCTCTCCAGCCTGGGGG - Intronic
1161358341 19:3832069-3832091 GGCTTCTCTCTCCTGCCATGGGG + Intronic
1162749487 19:12819837-12819859 GCCTTTGCACTCCAGCCTGGGGG + Intronic
1164397126 19:27876156-27876178 GGCTTTTCTCACCTGCCTTTTGG + Intergenic
1166342178 19:42144771-42144793 GCCCTCTCTGACCCGCCTTGGGG - Intronic
1168115089 19:54217928-54217950 GCATTTTGTCTCCCACCGTGAGG + Intronic
1168120782 19:54251620-54251642 GCATTTTGTCTCCCACCATGAGG + Intronic
1168124361 19:54275517-54275539 GCATTTTGTCTCCCACCATGAGG + Intronic
925867676 2:8243435-8243457 TCCTTTGCACTCCCGTCTTGCGG - Intergenic
926669460 2:15562474-15562496 ACCTTTTCGCTCCCTCCATGCGG - Intergenic
927157340 2:20228493-20228515 GCCATTGCTCTCCAGCCTGGGGG - Intergenic
929504458 2:42517530-42517552 GCCATTGCACTCCAGCCTTGGGG + Intronic
931067826 2:58606759-58606781 TCCTTTTCTCTCCTACCTTTTGG - Intergenic
931964868 2:67522229-67522251 GGCTTTTCTCCCCAACCTTGGGG - Intergenic
932500323 2:72177616-72177638 GCCTGGTCTCTCCAGCTTTGAGG + Exonic
933179194 2:79210906-79210928 GCCCTCCCTCTCCCGCCTGGGGG + Intronic
933720865 2:85396711-85396733 GCCTTTTCTCTCCTGCCAGAGGG - Intronic
935579386 2:104743693-104743715 GCCTTTTCTCTCCCTCCTCTGGG - Intergenic
936010955 2:108925059-108925081 GCATTCTCTCTCCCACCTAGGGG + Intronic
937114182 2:119392522-119392544 GCCTCTTCTCACCTGCCTGGTGG + Intergenic
938288620 2:130137883-130137905 TCCTTTTCTCTCCTGCCTTGGGG + Intergenic
938426969 2:131201004-131201026 TCCTTTTCTCTCCTGCCTTGGGG - Intronic
938467913 2:131535049-131535071 TCCTTTTCTTTCCTGCCTTGGGG - Intergenic
938510230 2:131935069-131935091 GCTTATTCTCTACCTCCTTGAGG - Intergenic
941588943 2:167394664-167394686 GCATTTTCTCTCCATCCCTGAGG + Intergenic
943969603 2:194386456-194386478 GCCTTTTGTATCCCCACTTGTGG - Intergenic
944088364 2:195875360-195875382 TCCTTTTTTCTCCCACCTTCTGG - Intronic
944743486 2:202634675-202634697 GCCTTTCCTTTCCCGCCGGGGGG - Intergenic
948135202 2:235631395-235631417 TCCTTGGCTCTCCCGCCTCGTGG - Intronic
948423352 2:237873936-237873958 GCCCTTTCTTTCCCGCCCTATGG - Intronic
1169010643 20:2247269-2247291 GCCTTTTTCCTCCCACCTGGAGG + Intergenic
1171976909 20:31600934-31600956 GCCATTGCACTCCAGCCTTGGGG + Intergenic
1172330050 20:34069297-34069319 GTCTTTTCTCTCATTCCTTGGGG - Intronic
1172833804 20:37859314-37859336 GCCTTTGCACTCCAGCCTGGGGG + Intronic
1173996896 20:47345546-47345568 GCCTTTGCACTCCGGCCTAGGGG - Intronic
1174389115 20:50206713-50206735 GCCTTTTCTTTCCCGCCTGTTGG + Intergenic
1174742626 20:53030239-53030261 GCCTCTTCCCTCCCACCTGGTGG + Intronic
1175795604 20:61768987-61769009 GGCTGGTCTCTCCCGCCTGGTGG - Intronic
1176046049 20:63093124-63093146 CACCTTTCTCTCCCGCCCTGTGG - Intergenic
1177981240 21:27917025-27917047 GCTTATTCTCTACCTCCTTGAGG + Intergenic
1180468091 22:15635045-15635067 TCCTTTTCTCTCCTGCCTTGGGG - Intergenic
1181696490 22:24595252-24595274 GGCTTTTCTCTGCCTGCTTGTGG + Intronic
1184766818 22:46576661-46576683 GCCTTTCCTCGACCGCCTCGCGG - Intronic
949106037 3:200772-200794 GCCTTTCCTCTCACCCCTTGGGG + Intronic
949194032 3:1283956-1283978 GCCTTTGCACTCCAGCCTGGGGG + Intronic
949357096 3:3192590-3192612 CCCTTCTTTCTCCAGCCTTGTGG - Intergenic
950240772 3:11368281-11368303 GCTTTTTCCCTCCCGGCTGGTGG + Intronic
952637198 3:35546273-35546295 TCCTTTTCTCTCCCTTGTTGGGG - Intergenic
952814866 3:37438495-37438517 GGCATTTCTCTACCTCCTTGAGG - Intergenic
953028700 3:39161643-39161665 GCCATTGCTCTCCAGCCTGGGGG + Intergenic
954400986 3:50319526-50319548 GCCTTTTTTCTCCTTCCTTGAGG - Intronic
954857423 3:53658097-53658119 GTCTTTTTTCTCCCACCTTGGGG + Intronic
955059870 3:55485279-55485301 GCCTTTTCTTCCCCGCGGTGCGG - Intronic
956202095 3:66717305-66717327 TCCATTTCCCTCCCGCCTTGTGG - Intergenic
956822045 3:72962807-72962829 CTCTTCTCTCTCCAGCCTTGAGG - Intronic
957072323 3:75576910-75576932 GACTTTTCTCTCCCTCCAGGAGG + Intergenic
960537070 3:118826273-118826295 CCCTTTTCTCTCCCTCCTTATGG + Intergenic
961281746 3:125769861-125769883 GACTTTTCTCTCCCTCCAGGAGG - Intergenic
961872599 3:129999723-129999745 GACTTTTCTCTCCCTCCAGGAGG + Intergenic
962485881 3:135841748-135841770 GACCTTTCTCTCCAGACTTGAGG + Intergenic
963618783 3:147577648-147577670 GCCTTTTCTCCCTCACCATGTGG + Intergenic
963680106 3:148363697-148363719 GCCTTTTCCCTCCCCCTTTCTGG + Intergenic
963919598 3:150892897-150892919 GCCATTGCACTCCAGCCTTGGGG + Intronic
966503994 3:180678989-180679011 GCCTTTCCTCTCTCGCCAGGAGG + Intronic
967533636 3:190577551-190577573 GCCTTTTCTTTCCCCCCTGCAGG + Intronic
968711651 4:2123762-2123784 GCCTCTGCTCTCCAGCCTAGGGG + Intronic
969015917 4:4104225-4104247 GACTTTTCTCTCCCTCCAGGAGG + Intergenic
969738036 4:9004127-9004149 GACTTTTCTCTCCCTCCAGGAGG - Intergenic
969797226 4:9535674-9535696 GACTTTTCTCTCCCTCCAGGAGG - Intergenic
970474973 4:16412829-16412851 CCCTTTTCTTTCCCTCCATGAGG - Intergenic
972816597 4:42653113-42653135 CCCGATTCTCTCCTGCCTTGGGG + Intronic
972917991 4:43904224-43904246 GCTTTCTCCCTCCCCCCTTGCGG - Intergenic
974131849 4:57766694-57766716 GTCTTTGCTCTCCAGCCTTGAGG + Intergenic
974498337 4:62662882-62662904 GGCTTTTCTTTCCAGCTTTGTGG + Intergenic
974732940 4:65893472-65893494 GCCTTTTCTCTCCTGCAAAGAGG - Intergenic
978328705 4:107587738-107587760 CCCTTTTCTCTCCCTTGTTGGGG - Intergenic
978377191 4:108087089-108087111 TCTTTTTCTCTCCTGCCTTAGGG - Intronic
978527422 4:109679758-109679780 GAACTTTCTCTCCCGCTTTGAGG + Intronic
978656404 4:111070411-111070433 GCTTTTTCTTTCTCCCCTTGGGG + Intergenic
979043287 4:115828452-115828474 GCCTTTTCAGTCACGCCTTTTGG - Intergenic
980088676 4:128418326-128418348 GACTTTTCTCTCCTGCCTCTGGG - Intergenic
980944873 4:139309305-139309327 GCCATTGCTCTCCAGCCTGGGGG + Intronic
982084992 4:151825602-151825624 GCCATTTTTCTCCCACCTTAAGG + Intergenic
983328031 4:166285170-166285192 GCCATTGCACTCCAGCCTTGGGG + Intergenic
988188700 5:27900560-27900582 ACCTTTACTGTCCCGCCTTGGGG + Intergenic
990759004 5:59107914-59107936 GGCTTTTCTCTCTCTCCATGTGG - Intronic
990868987 5:60410303-60410325 GACTTTTCTCTCCCACCAAGAGG + Intronic
990927426 5:61043177-61043199 GCCATTGCACTCCAGCCTTGGGG + Intronic
991590525 5:68246924-68246946 GCCTTTCCTCTCCCCTCTTAAGG - Intronic
992068796 5:73130577-73130599 GCCTTTTCTCTGGGGCCTGGAGG + Intronic
992341712 5:75831476-75831498 ACCGTTTCTCTGCCGCCTGGAGG + Intergenic
993562643 5:89429854-89429876 GCCTTTTGTCTTCCACCTTAAGG - Intergenic
994968722 5:106708089-106708111 GCATTTTCTCTGCTGCCTTTTGG + Intergenic
996175838 5:120355730-120355752 TCCTTTTGTTTCCCGTCTTGAGG + Intergenic
998313236 5:141156013-141156035 GCCTTTTCTCTGGTGCTTTGGGG - Intergenic
998601122 5:143586286-143586308 GCCTTTTCTCTGCCTACATGTGG - Intergenic
1000491141 5:161915279-161915301 GCCATTGCACTCCAGCCTTGGGG - Intergenic
1001144495 5:169171877-169171899 GGCTATTCTCTGCCCCCTTGGGG + Intronic
1002690861 5:181049670-181049692 CCCTTATCTCTCCATCCTTGTGG - Intronic
1003852423 6:10238912-10238934 GCCTCTTCTCTCTAGCCTTGTGG + Intergenic
1003974637 6:11330663-11330685 GCTTTTTCTCTTCCTCCTTGTGG + Intronic
1007115346 6:39339404-39339426 GCCTTTTCCCTCCCAGCTCGGGG + Intronic
1010612542 6:77971689-77971711 TCCTTTTCTCTGCAGCCTTATGG - Intergenic
1011550642 6:88528434-88528456 GCCTCTTCTCTCCTTCCTGGAGG + Intergenic
1011717471 6:90122489-90122511 GTCTTTTCTCTTTCTCCTTGAGG + Intronic
1011799884 6:91000439-91000461 GCCTTTTCACTCATCCCTTGGGG + Intergenic
1012642962 6:101644806-101644828 GCATTTTCTCACCCTCTTTGAGG + Intronic
1013935518 6:115588395-115588417 GCCTTTTGCCTCCTGCCATGTGG + Intergenic
1014362665 6:120499610-120499632 GCCATTGCACTCCAGCCTTGGGG - Intergenic
1015734737 6:136386849-136386871 GCCTTTGCACTCCAGCCTAGAGG - Intronic
1015929176 6:138339797-138339819 ACCTTCTCTCTCTCCCCTTGTGG + Exonic
1017081684 6:150675430-150675452 GCTTTTTCTCTCACGCTTTCTGG + Intronic
1018870239 6:167777104-167777126 CCCTTTGCTCTCCAGCCTTAGGG - Intergenic
1019538847 7:1542453-1542475 GCCGGTTCTGTCCCGTCTTGGGG + Exonic
1019580772 7:1760980-1761002 GCCACTGCTCTCCAGCCTTGGGG + Intergenic
1019971276 7:4542903-4542925 GCCTTCTCTCCCTCGCCTGGTGG + Intergenic
1020685170 7:11285612-11285634 GGCTTCTCTATCCTGCCTTGGGG + Intergenic
1021492194 7:21231439-21231461 GCCATTTCTCTCCCACCAAGAGG + Intergenic
1021729779 7:23585112-23585134 TCCTTTCTTCTCCCGCCTTTGGG - Intergenic
1023563507 7:41500452-41500474 GCCTTTTCTCACCAGCAGTGTGG - Intergenic
1025747710 7:64258950-64258972 GCCATTTCACTCCAGCCTGGGGG - Intronic
1027255177 7:76426375-76426397 GCCTGTCCTCTCCCGCCTCAGGG + Intronic
1027257653 7:76441427-76441449 GCCATTGCTCTCCAGCCTGGAGG - Intronic
1027281195 7:76610609-76610631 GCCATTGCTCTCCAGCCTGGAGG + Intronic
1027656348 7:80935198-80935220 GCCATTGCACTCCAGCCTTGGGG + Intergenic
1027833858 7:83216305-83216327 GCCCTTGCACTCCAGCCTTGGGG + Intergenic
1030712971 7:112774619-112774641 GCCATTGCTCTCCAGCCTGGGGG - Intronic
1031446468 7:121860966-121860988 CCCTTTGTTCTCCAGCCTTGAGG + Intergenic
1033427180 7:141254678-141254700 GCCATTTCACTCCAGCCTGGGGG + Intronic
1033685693 7:143639639-143639661 GCCTTTTCTCTCCCGCCTTGTGG + Intronic
1033690050 7:143727676-143727698 GCCTTTTCTCTCCCGCCTTGTGG - Intronic
1033698921 7:143817982-143818004 GCCTTTTCTCTCCCGCCTTGTGG - Intergenic
1034916729 7:155046291-155046313 GCCATTGCTCTCCAGCCTGGGGG - Intergenic
1036243120 8:7095401-7095423 GACTTTTCTCTCCCTCCAGGAGG - Intergenic
1036257679 8:7218643-7218665 GACTTTTCTCTCCCTCCAGGAGG + Intergenic
1036258930 8:7225642-7225664 GACTTTTCTCTCCCTCCAGGAGG + Intergenic
1036307691 8:7613868-7613890 GACTTTTCTCTCCCTCCAGGAGG - Intergenic
1036310983 8:7684238-7684260 GACTTTTCTCTCCCTCCAGGAGG + Intergenic
1036358546 8:8061869-8061891 GACTTTTCTCTCCCTCCATGAGG - Intergenic
1036704867 8:11039495-11039517 GCCTTTTCTCTTCCGAGATGAGG + Intronic
1036892414 8:12605083-12605105 GACTTTTCTCTCCCTCCAGGAGG + Intergenic
1036899958 8:12663059-12663081 GACTTTTCTCTCCCTCCAGGAGG + Intergenic
1036944423 8:13081355-13081377 TCCTTTTCTCTGGCGACTTGTGG - Intergenic
1037348332 8:17923235-17923257 GCCGTTACTCTCCCGCCTCTGGG - Intronic
1037742148 8:21616403-21616425 GCCTTTTCTTCCCCTCCCTGTGG - Intergenic
1038346927 8:26741387-26741409 GGCTTTTCTCTCCCCTCATGAGG + Intergenic
1038446142 8:27605515-27605537 TCCTTTTATCTCCCTCCATGGGG + Intronic
1040641600 8:49340793-49340815 GCCCTTTTTCTCCTGCCTTTAGG - Intergenic
1041344307 8:56880183-56880205 GCCATTTCTGTCTTGCCTTGTGG - Intergenic
1042921610 8:73925445-73925467 GCCATTGCACTCCCGCCTGGGGG + Intergenic
1043328166 8:79079004-79079026 GTCTATTATCTCCCGCATTGTGG - Intergenic
1043540576 8:81257820-81257842 ACCTTTTCTATCCCACCTTCTGG - Intergenic
1043712711 8:83442169-83442191 CCCTTTTCTCTACAGCCTTGTGG + Intergenic
1044623224 8:94211350-94211372 GCCATTGCACTCCAGCCTTGGGG - Intronic
1045338015 8:101225698-101225720 TCCTTTTCTCTGCCACCCTGTGG + Intergenic
1046182848 8:110674938-110674960 GCCATTTCACTCCAGCCTAGAGG - Intergenic
1046720575 8:117614159-117614181 GCCTTTACTCACACTCCTTGAGG - Intergenic
1049095912 8:140547961-140547983 GCTCTTTCTCTCCTGCCCTGGGG - Intronic
1049116459 8:140692574-140692596 GCCATTTCACTCCAGCCTGGGGG + Intronic
1049404764 8:142447450-142447472 GCCTTTCCTCTCCCAGCATGGGG - Intergenic
1049862608 8:144910283-144910305 ACCTTTTCACACCCCCCTTGGGG - Intergenic
1050622333 9:7467431-7467453 GCTTTTTCCCTACTGCCTTGAGG + Intergenic
1050905251 9:10994843-10994865 GCCTTTCCTCTCCCACCATATGG + Intergenic
1058465488 9:105222909-105222931 GCCTGTTCCCTCCTGCCTTGAGG - Intergenic
1059117444 9:111612402-111612424 GCTTTTTCACTCTCGGCTTGTGG - Intergenic
1061253400 9:129439549-129439571 GCCTGTTCTCTGCAGCCCTGAGG - Intergenic
1061262251 9:129486846-129486868 GCCTTTTCTCCCCTCCCTTTGGG - Intergenic
1061441992 9:130611470-130611492 GTCTTCTCCCTCCCTCCTTGAGG - Intronic
1187155945 X:16720397-16720419 GCATTTTCTCTCCCTCCTTAAGG - Intronic
1189378128 X:40481602-40481624 GCCTCTGCTCTCCAGCCATGTGG + Intergenic
1190388041 X:49902872-49902894 GCCATTGCTCTCCAGCCTGGGGG - Intergenic
1192498507 X:71632860-71632882 GCCTCATCTCTCCCATCTTGAGG - Intergenic
1192537081 X:71937327-71937349 GCTTTGACTCTCCAGCCTTGTGG - Intergenic
1192792869 X:74400081-74400103 GCCATTGCACTCCAGCCTTGGGG + Intergenic
1193360572 X:80574457-80574479 GCCCTTTCTCTATCTCCTTGCGG + Intergenic
1196734932 X:118974965-118974987 GACTTTGCTCTCCGGCGTTGAGG - Exonic
1197869681 X:131053199-131053221 GCAATTTCTCTGCCTCCTTGGGG + Intergenic