ID: 1033688172

View in Genome Browser
Species Human (GRCh38)
Location 7:143710090-143710112
Sequence TAACCCAAGCTGCAACAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 3, 1: 0, 2: 0, 3: 2, 4: 120}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033688172_1033688180 18 Left 1033688172 7:143710090-143710112 CCCCCTTGTTGCAGCTTGGGTTA 0: 3
1: 0
2: 0
3: 2
4: 120
Right 1033688180 7:143710131-143710153 GATAGAGATACATGTGTGGGAGG No data
1033688172_1033688179 15 Left 1033688172 7:143710090-143710112 CCCCCTTGTTGCAGCTTGGGTTA 0: 3
1: 0
2: 0
3: 2
4: 120
Right 1033688179 7:143710128-143710150 AGAGATAGAGATACATGTGTGGG No data
1033688172_1033688182 28 Left 1033688172 7:143710090-143710112 CCCCCTTGTTGCAGCTTGGGTTA 0: 3
1: 0
2: 0
3: 2
4: 120
Right 1033688182 7:143710141-143710163 CATGTGTGGGAGGTTTGTGAGGG No data
1033688172_1033688181 27 Left 1033688172 7:143710090-143710112 CCCCCTTGTTGCAGCTTGGGTTA 0: 3
1: 0
2: 0
3: 2
4: 120
Right 1033688181 7:143710140-143710162 ACATGTGTGGGAGGTTTGTGAGG 0: 3
1: 0
2: 2
3: 21
4: 284
1033688172_1033688178 14 Left 1033688172 7:143710090-143710112 CCCCCTTGTTGCAGCTTGGGTTA 0: 3
1: 0
2: 0
3: 2
4: 120
Right 1033688178 7:143710127-143710149 CAGAGATAGAGATACATGTGTGG 0: 3
1: 1
2: 3
3: 28
4: 386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033688172 Original CRISPR TAACCCAAGCTGCAACAAGG GGG (reversed) Intronic
901866922 1:12112427-12112449 TCACCCAAGCTGCAGTACGGTGG + Intronic
902902172 1:19525370-19525392 TCACCCAAGCTGGAACACAGTGG + Intergenic
904399682 1:30247987-30248009 TCACCCAAGCTGGAAGAAGTGGG - Intergenic
906104076 1:43281367-43281389 TCACCCAAGCTGCAGTATGGTGG - Intergenic
908809393 1:67964370-67964392 CAACCCAAGCTTCAAAAAAGAGG + Intergenic
917413857 1:174787825-174787847 TAACCAAGGCTGCAACAATAGGG + Intronic
1072655892 10:97330277-97330299 TATCCCAAGCTGCAACACCTTGG + Intergenic
1077440165 11:2564889-2564911 TCACACAGGCTGCAACATGGAGG - Intronic
1079912550 11:26329563-26329585 TAATCATAGCTGCACCAAGGAGG + Intronic
1084004109 11:66314222-66314244 TTACCAAAGCTCCAAGAAGGTGG - Intergenic
1084285009 11:68125298-68125320 CAACCCAATCTTCAACATGGAGG - Intergenic
1089791368 11:120946986-120947008 TAACCAAAGGTGGAACAAGTTGG - Intronic
1090368050 11:126224434-126224456 TCACCCAGGCTGGAACATGGTGG - Intronic
1094144377 12:27213896-27213918 TCACCCCAGCTGCAGCAGGGAGG + Intergenic
1094175313 12:27535451-27535473 TCACCCAAGCTACAGCGAGGTGG + Intronic
1096350379 12:50893756-50893778 TCACCCAGGCTGCAGTAAGGTGG - Intergenic
1104728744 12:131093728-131093750 TAACCCCAGCTGCATGCAGGAGG - Intronic
1107228669 13:38082310-38082332 TAAACCATGCTGCAACAAACTGG - Intergenic
1108435224 13:50396038-50396060 AAAACCAAGCTGCAAAGAGGAGG + Intronic
1112887890 13:104195916-104195938 TAACTCAATGTGCAACAAAGGGG - Intergenic
1112917509 13:104569638-104569660 GAACCCAAGCTGCAAATATGGGG - Intergenic
1114419657 14:22570723-22570745 TGATCCTAGCTGGAACAAGGGGG - Intronic
1114676620 14:24444728-24444750 TTACCCAGGCTGCAGCACGGTGG - Intergenic
1117301269 14:54430869-54430891 TAACCCAGGCTGCAATATAGTGG + Intronic
1118017491 14:61674983-61675005 TACCACCAGCTGCAACCAGGTGG - Intergenic
1119580420 14:75774078-75774100 TAACCTAAGCTGGAACACAGAGG - Intronic
1121440958 14:93948973-93948995 TAATCCATGCTGCTAGAAGGAGG + Intronic
1123685477 15:22794203-22794225 TCACACATGCTGCAACATGGAGG + Intronic
1124517012 15:30375192-30375214 TAACAGAAGCTGCAACACGCAGG + Intronic
1124725906 15:32155525-32155547 TAACAGAAGCTGCAACACGCAGG - Intronic
1125239010 15:37550941-37550963 TCACCCTGGCTGCAACAGGGAGG - Intergenic
1125498420 15:40220013-40220035 TAACACAAGCAGAAACAAGTGGG + Intronic
1126590444 15:50334545-50334567 TCACCCAGGCTGCAGCATGGTGG + Intronic
1128790803 15:70432146-70432168 TCACACAGGCTGCAGCAAGGAGG - Intergenic
1133059994 16:3168321-3168343 TTACCCAGGCTGCAGCATGGTGG + Intergenic
1133356656 16:5141836-5141858 CAGCCCTACCTGCAACAAGGTGG - Intergenic
1134078583 16:11309189-11309211 TCACTCCAGCTGCAGCAAGGAGG - Intronic
1134659589 16:15973943-15973965 TCACCCAAGCTGGAATACGGTGG - Intronic
1138635166 16:58332445-58332467 TGACTCATGCTGCAACACGGTGG - Intronic
1141745491 16:85923258-85923280 TCACCCCAGCTGCATCCAGGAGG - Intergenic
1143076131 17:4344819-4344841 TAGCCCAGGCTGCAATGAGGTGG - Intronic
1146474755 17:33153859-33153881 TAACCCAAGTTGGGCCAAGGTGG - Intronic
1148319277 17:46736360-46736382 TAACTCATGGTGCAACAAAGTGG + Intronic
1148705229 17:49624506-49624528 TAACCCAGGCTGCAGCACAGTGG + Intronic
1156668238 18:39434835-39434857 AAACTCAAAATGCAACAAGGGGG - Intergenic
1156898426 18:42273097-42273119 GAACCCAGCCTGCAACCAGGAGG + Intergenic
1157913526 18:51641694-51641716 TTAGCCCAGCTTCAACAAGGGGG + Intergenic
1158200812 18:54938033-54938055 AAATCCAAACTGCAACAAGAAGG + Exonic
1158406484 18:57164533-57164555 GCACCCCAGCTGCAACAACGAGG + Intergenic
1159050778 18:63419292-63419314 TAATCCCAGCTGCTACATGGGGG + Intronic
1160038374 18:75321785-75321807 GAACCCAAGCTGCAACACTCTGG + Intergenic
1161082118 19:2316475-2316497 TCACCCAAGCTGCAGTGAGGTGG + Intronic
1163317071 19:16548101-16548123 TCACCTAAGCAGCAACATGGAGG + Intronic
1165821358 19:38678394-38678416 TAAACCCAGCTGCAGGAAGGTGG - Intronic
1166712543 19:44946480-44946502 TCACCCAGGCTGGAACACGGTGG - Intronic
928716497 2:34067000-34067022 TAACCTGAGATGCAACAAAGAGG - Intergenic
928914907 2:36460131-36460153 TAACCACAGCTGCAGCCAGGTGG - Intronic
929206768 2:39304889-39304911 TGACACACGCTGCAACACGGAGG + Intronic
930454042 2:51582076-51582098 TAACACAAGCTGCCTCTAGGCGG + Intergenic
932570472 2:72935821-72935843 GAAACCTAGCTGCAACATGGAGG - Intronic
934699729 2:96429985-96430007 TCACACAAGCTGCAGCAGGGAGG + Intergenic
935390530 2:102547740-102547762 TAACCTAAGTTCCAACAAGCAGG - Intergenic
937085359 2:119168158-119168180 TCACCCAAGCTGCAATGCGGTGG - Intergenic
941296762 2:163748653-163748675 AAAGCCAAGCTGAAACATGGTGG + Intergenic
943462915 2:188191906-188191928 AACCCCCAGCAGCAACAAGGAGG - Intergenic
946941959 2:224778599-224778621 TACCCCAAGCTGCCACAAGAGGG - Intronic
947829439 2:233128515-233128537 TCACCCAAGCTGGAACACAGTGG + Intronic
948595548 2:239077111-239077133 TCACCTAAGCTGCCACAAGACGG + Intronic
1170318047 20:15063866-15063888 TAAATCTAGCTGCAACAAGTTGG + Intronic
1174224436 20:48985434-48985456 TAGCGCAAGGTTCAACAAGGAGG + Exonic
1178049928 21:28736178-28736200 TAGCTCTTGCTGCAACAAGGTGG + Intergenic
1179138311 21:38699852-38699874 TAACCCCAGCTGATACAAGCAGG - Intergenic
1179513782 21:41892502-41892524 GAACCCAGGCAGCAACATGGAGG + Intronic
1184958543 22:47910800-47910822 TAAACCAAATTGCAACATGGTGG + Intergenic
951562562 3:23982655-23982677 TCACACCAGCTGCAGCAAGGAGG - Intergenic
951667002 3:25137688-25137710 TAAACAAAGTTGCAACAAAGAGG - Intergenic
955777338 3:62447973-62447995 TAAGCCACCCTGCAAAAAGGGGG + Intronic
955987530 3:64589698-64589720 TAACCTATACTGCAAAAAGGAGG + Intronic
956354316 3:68374218-68374240 TGACTCAAGCTGCACCAAAGTGG - Intronic
957439513 3:80225579-80225601 TAACCAAAACAGCAACAAAGAGG + Intergenic
959217247 3:103466771-103466793 TCACCCAAGCTGGAACACAGTGG - Intergenic
961371130 3:126432530-126432552 TGACACATGCTGCAACATGGAGG + Intronic
962893657 3:139694940-139694962 TAACTCAAGGTACAACAAGAAGG + Intergenic
968425529 4:520509-520531 TAACCCAGGCTGCAGAACGGGGG + Intronic
969984661 4:11195661-11195683 TTACCCAGAGTGCAACAAGGAGG - Intergenic
977427900 4:96892197-96892219 CAAACCAAGGTGCAACAAGTGGG + Intergenic
984974040 4:185214531-185214553 TAACCCAGGCTGGAATATGGCGG - Intronic
986068513 5:4259461-4259483 GAGCCCAAGCTGCAGCATGGTGG + Intergenic
986619499 5:9657592-9657614 TGACCCATGCTACAACATGGAGG + Intronic
987061506 5:14248099-14248121 TAACCCCAGCTGCAAAGAAGGGG - Intronic
988591051 5:32550074-32550096 TAACACATGCTACAACATGGAGG - Intronic
989733609 5:44676433-44676455 TCACCCAGGCTGGAACAAAGTGG - Intergenic
997589238 5:135062800-135062822 TGTCCCAAGCTGCAGCTAGGAGG - Intronic
1000477098 5:161724309-161724331 TCTTACAAGCTGCAACAAGGTGG - Intergenic
1001822559 5:174721257-174721279 TAACCCCAGCGGCTAGAAGGGGG - Intergenic
1005735464 6:28741622-28741644 TAACAAAAGCAGAAACAAGGAGG - Intergenic
1005880326 6:30053104-30053126 TCACCCAGGCTGCAACACAGTGG + Intergenic
1009305182 6:62080840-62080862 CAAACCAAGATGCAGCAAGGTGG - Intronic
1014952664 6:127576397-127576419 TAATCCAAGCCACAACATGGAGG + Intronic
1018628548 6:165803588-165803610 TAACCTAGCCTGGAACAAGGTGG + Intronic
1026284624 7:68952472-68952494 TCACCCAGGCTGCAACACAGTGG + Intergenic
1026342233 7:69444527-69444549 TCACCCAGGCTGGAGCAAGGTGG + Intergenic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1028655835 7:93205786-93205808 TAACTCAAACAGCAACAAGATGG - Intronic
1029180706 7:98699560-98699582 AAACTCATTCTGCAACAAGGAGG - Intergenic
1031057514 7:117009807-117009829 TAACCACAGCTGGAAAAAGGAGG - Intronic
1033411418 7:141121406-141121428 TAACTCAAGCTGGAAGAAAGAGG - Intronic
1033684999 7:143630871-143630893 TAACCCAAGCTGCAACAAGGGGG - Intronic
1033688172 7:143710090-143710112 TAACCCAAGCTGCAACAAGGGGG - Intronic
1033699614 7:143826750-143826772 TAACCCAAGCTGCAACAAGGGGG + Intergenic
1035857616 8:2993317-2993339 TAACCTTACCTTCAACAAGGGGG - Intronic
1035953986 8:4056119-4056141 TCACCCAAGCTGCAATACAGTGG + Intronic
1037946542 8:22993197-22993219 TCACCCAAGCTGCAGTACGGTGG + Intronic
1038113820 8:24530181-24530203 AAAGCCAAGGTGCTACAAGGTGG + Intergenic
1047122888 8:121926032-121926054 TCACCCAGGCTGCAACACAGTGG - Intergenic
1047458733 8:125041290-125041312 TAATGCAAGCAGCAATAAGGTGG + Intronic
1053023115 9:34709313-34709335 GAACCCAAGATGCAAGAAGGAGG - Exonic
1055816179 9:80209728-80209750 TGACCTAAGCTGCAACAACCAGG + Intergenic
1056540047 9:87563457-87563479 CAAGCCAAGATGCAACAGGGAGG - Intronic
1058975620 9:110123077-110123099 CAACCCAAGCTGCAAAAATAGGG - Intronic
1061259110 9:129469840-129469862 CAACACAAGCTGCACCCAGGCGG + Intergenic
1185977753 X:4740440-4740462 TAACACAGGCTACAACATGGAGG + Intergenic
1190305612 X:49079935-49079957 TCACCCCAGCTGGAAAAAGGCGG + Intronic
1195482230 X:105358980-105359002 TATCCCAAATTGAAACAAGGGGG + Intronic
1196271078 X:113711698-113711720 AAACACAAGGTGCAAAAAGGTGG - Intergenic