ID: 1033690050

View in Genome Browser
Species Human (GRCh38)
Location 7:143727676-143727698
Sequence GCCTTTTCTCTCCCGCCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 3, 1: 0, 2: 5, 3: 18, 4: 246}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033690050_1033690057 12 Left 1033690050 7:143727676-143727698 CCACAAGGCGGGAGAGAAAAGGC 0: 3
1: 0
2: 5
3: 18
4: 246
Right 1033690057 7:143727711-143727733 TCAACTCCACCATGGGGCTTTGG 0: 3
1: 0
2: 0
3: 8
4: 119
1033690050_1033690054 5 Left 1033690050 7:143727676-143727698 CCACAAGGCGGGAGAGAAAAGGC 0: 3
1: 0
2: 5
3: 18
4: 246
Right 1033690054 7:143727704-143727726 CACGCCATCAACTCCACCATGGG 0: 3
1: 0
2: 0
3: 13
4: 109
1033690050_1033690055 6 Left 1033690050 7:143727676-143727698 CCACAAGGCGGGAGAGAAAAGGC 0: 3
1: 0
2: 5
3: 18
4: 246
Right 1033690055 7:143727705-143727727 ACGCCATCAACTCCACCATGGGG 0: 3
1: 0
2: 0
3: 7
4: 61
1033690050_1033690053 4 Left 1033690050 7:143727676-143727698 CCACAAGGCGGGAGAGAAAAGGC 0: 3
1: 0
2: 5
3: 18
4: 246
Right 1033690053 7:143727703-143727725 TCACGCCATCAACTCCACCATGG 0: 3
1: 0
2: 0
3: 6
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033690050 Original CRISPR GCCTTTTCTCTCCCGCCTTG TGG (reversed) Intronic