ID: 1033690362

View in Genome Browser
Species Human (GRCh38)
Location 7:143730481-143730503
Sequence TCTGATATCCAGAATCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 10319
Summary {0: 3, 1: 53, 2: 1166, 3: 4082, 4: 5015}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033690362_1033690365 23 Left 1033690362 7:143730481-143730503 CCTTGCAGATTCTGGATATCAGA 0: 3
1: 53
2: 1166
3: 4082
4: 5015
Right 1033690365 7:143730527-143730549 AAAATTTTCTCCCATTCTGTAGG 0: 8879
1: 14882
2: 10936
3: 7247
4: 5330
1033690362_1033690364 -9 Left 1033690362 7:143730481-143730503 CCTTGCAGATTCTGGATATCAGA 0: 3
1: 53
2: 1166
3: 4082
4: 5015
Right 1033690364 7:143730495-143730517 GATATCAGAACTTGTCAGATGGG No data
1033690362_1033690363 -10 Left 1033690362 7:143730481-143730503 CCTTGCAGATTCTGGATATCAGA 0: 3
1: 53
2: 1166
3: 4082
4: 5015
Right 1033690363 7:143730494-143730516 GGATATCAGAACTTGTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033690362 Original CRISPR TCTGATATCCAGAATCTGCA AGG (reversed) Intergenic
Too many off-targets to display for this crispr