ID: 1033692154

View in Genome Browser
Species Human (GRCh38)
Location 7:143747225-143747247
Sequence GTGAATGGCTGTGATTGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033692154_1033692158 22 Left 1033692154 7:143747225-143747247 CCAGTTCAATCACAGCCATTCAC No data
Right 1033692158 7:143747270-143747292 TTTTCAGAGAAATGAACATGAGG No data
1033692154_1033692160 26 Left 1033692154 7:143747225-143747247 CCAGTTCAATCACAGCCATTCAC No data
Right 1033692160 7:143747274-143747296 CAGAGAAATGAACATGAGGAGGG No data
1033692154_1033692156 -4 Left 1033692154 7:143747225-143747247 CCAGTTCAATCACAGCCATTCAC No data
Right 1033692156 7:143747244-143747266 TCACATCATCTAGTACCAAGTGG No data
1033692154_1033692159 25 Left 1033692154 7:143747225-143747247 CCAGTTCAATCACAGCCATTCAC No data
Right 1033692159 7:143747273-143747295 TCAGAGAAATGAACATGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033692154 Original CRISPR GTGAATGGCTGTGATTGAAC TGG (reversed) Intergenic
No off target data available for this crispr