ID: 1033692155

View in Genome Browser
Species Human (GRCh38)
Location 7:143747240-143747262
Sequence TTGGTACTAGATGATGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033692155_1033692158 7 Left 1033692155 7:143747240-143747262 CCATTCACATCATCTAGTACCAA No data
Right 1033692158 7:143747270-143747292 TTTTCAGAGAAATGAACATGAGG No data
1033692155_1033692159 10 Left 1033692155 7:143747240-143747262 CCATTCACATCATCTAGTACCAA No data
Right 1033692159 7:143747273-143747295 TCAGAGAAATGAACATGAGGAGG No data
1033692155_1033692161 26 Left 1033692155 7:143747240-143747262 CCATTCACATCATCTAGTACCAA No data
Right 1033692161 7:143747289-143747311 GAGGAGGGAAACTCCTTGACTGG No data
1033692155_1033692160 11 Left 1033692155 7:143747240-143747262 CCATTCACATCATCTAGTACCAA No data
Right 1033692160 7:143747274-143747296 CAGAGAAATGAACATGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033692155 Original CRISPR TTGGTACTAGATGATGTGAA TGG (reversed) Intergenic
No off target data available for this crispr