ID: 1033692156

View in Genome Browser
Species Human (GRCh38)
Location 7:143747244-143747266
Sequence TCACATCATCTAGTACCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033692153_1033692156 5 Left 1033692153 7:143747216-143747238 CCTAATTAACCAGTTCAATCACA No data
Right 1033692156 7:143747244-143747266 TCACATCATCTAGTACCAAGTGG No data
1033692154_1033692156 -4 Left 1033692154 7:143747225-143747247 CCAGTTCAATCACAGCCATTCAC No data
Right 1033692156 7:143747244-143747266 TCACATCATCTAGTACCAAGTGG No data
1033692152_1033692156 6 Left 1033692152 7:143747215-143747237 CCCTAATTAACCAGTTCAATCAC No data
Right 1033692156 7:143747244-143747266 TCACATCATCTAGTACCAAGTGG No data
1033692151_1033692156 13 Left 1033692151 7:143747208-143747230 CCTATTACCCTAATTAACCAGTT No data
Right 1033692156 7:143747244-143747266 TCACATCATCTAGTACCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033692156 Original CRISPR TCACATCATCTAGTACCAAG TGG Intergenic
No off target data available for this crispr