ID: 1033692159

View in Genome Browser
Species Human (GRCh38)
Location 7:143747273-143747295
Sequence TCAGAGAAATGAACATGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033692157_1033692159 -9 Left 1033692157 7:143747259-143747281 CCAAGTGGTATTTTTCAGAGAAA No data
Right 1033692159 7:143747273-143747295 TCAGAGAAATGAACATGAGGAGG No data
1033692155_1033692159 10 Left 1033692155 7:143747240-143747262 CCATTCACATCATCTAGTACCAA No data
Right 1033692159 7:143747273-143747295 TCAGAGAAATGAACATGAGGAGG No data
1033692154_1033692159 25 Left 1033692154 7:143747225-143747247 CCAGTTCAATCACAGCCATTCAC No data
Right 1033692159 7:143747273-143747295 TCAGAGAAATGAACATGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033692159 Original CRISPR TCAGAGAAATGAACATGAGG AGG Intergenic
No off target data available for this crispr