ID: 1033698921

View in Genome Browser
Species Human (GRCh38)
Location 7:143817982-143818004
Sequence GCCTTTTCTCTCCCGCCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033698921_1033698926 6 Left 1033698921 7:143817982-143818004 CCACAAGGCGGGAGAGAAAAGGC No data
Right 1033698926 7:143818011-143818033 ACGCCATCAACTCCACCATGGGG No data
1033698921_1033698924 4 Left 1033698921 7:143817982-143818004 CCACAAGGCGGGAGAGAAAAGGC No data
Right 1033698924 7:143818009-143818031 TCACGCCATCAACTCCACCATGG No data
1033698921_1033698928 12 Left 1033698921 7:143817982-143818004 CCACAAGGCGGGAGAGAAAAGGC No data
Right 1033698928 7:143818017-143818039 TCAACTCCACCATGGGGCTTTGG No data
1033698921_1033698925 5 Left 1033698921 7:143817982-143818004 CCACAAGGCGGGAGAGAAAAGGC No data
Right 1033698925 7:143818010-143818032 CACGCCATCAACTCCACCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033698921 Original CRISPR GCCTTTTCTCTCCCGCCTTG TGG (reversed) Intergenic