ID: 1033703412

View in Genome Browser
Species Human (GRCh38)
Location 7:143861664-143861686
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 2, 1: 0, 2: 1, 3: 9, 4: 148}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033703412_1033703419 -1 Left 1033703412 7:143861664-143861686 CCTATCTCATGGTGGTGATTCTG 0: 2
1: 0
2: 1
3: 9
4: 148
Right 1033703419 7:143861686-143861708 GGCATTTGGAATGGGGCAGAGGG 0: 2
1: 0
2: 1
3: 29
4: 299
1033703412_1033703418 -2 Left 1033703412 7:143861664-143861686 CCTATCTCATGGTGGTGATTCTG 0: 2
1: 0
2: 1
3: 9
4: 148
Right 1033703418 7:143861685-143861707 TGGCATTTGGAATGGGGCAGAGG No data
1033703412_1033703416 -9 Left 1033703412 7:143861664-143861686 CCTATCTCATGGTGGTGATTCTG 0: 2
1: 0
2: 1
3: 9
4: 148
Right 1033703416 7:143861678-143861700 GTGATTCTGGCATTTGGAATGGG 0: 2
1: 0
2: 5
3: 21
4: 211
1033703412_1033703415 -10 Left 1033703412 7:143861664-143861686 CCTATCTCATGGTGGTGATTCTG 0: 2
1: 0
2: 1
3: 9
4: 148
Right 1033703415 7:143861677-143861699 GGTGATTCTGGCATTTGGAATGG No data
1033703412_1033703417 -8 Left 1033703412 7:143861664-143861686 CCTATCTCATGGTGGTGATTCTG 0: 2
1: 0
2: 1
3: 9
4: 148
Right 1033703417 7:143861679-143861701 TGATTCTGGCATTTGGAATGGGG No data
1033703412_1033703422 28 Left 1033703412 7:143861664-143861686 CCTATCTCATGGTGGTGATTCTG 0: 2
1: 0
2: 1
3: 9
4: 148
Right 1033703422 7:143861715-143861737 GCCTTTTGCTGATCAGAGAGAGG No data
1033703412_1033703424 29 Left 1033703412 7:143861664-143861686 CCTATCTCATGGTGGTGATTCTG 0: 2
1: 0
2: 1
3: 9
4: 148
Right 1033703424 7:143861716-143861738 CCTTTTGCTGATCAGAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033703412 Original CRISPR CAGAATCACCACCATGAGAT AGG (reversed) Intronic
901051893 1:6429513-6429535 CAGAATCACCGCCGTGAGGGTGG - Intronic
901782458 1:11602848-11602870 CAGTGTCCCCACCATGTGATGGG + Intergenic
902464206 1:16605114-16605136 CATGACCACCACCATGAAATTGG - Intronic
902482342 1:16718501-16718523 CAGAATCACCGCCATGAGGGTGG + Intergenic
903587550 1:24427698-24427720 CACAAACAACACTATGAGATGGG - Intronic
914866288 1:151432246-151432268 CAAAATCACCAGAATGGGATGGG + Intronic
916205764 1:162315029-162315051 GAAACTCACCAACATGAGATTGG - Intronic
916308598 1:163368760-163368782 TAGAATCACATCCATGAAATGGG - Intergenic
916572247 1:166038085-166038107 CAGACTAACCACCATGTGGTTGG - Intergenic
917956602 1:180105706-180105728 AAGAATCACCACAATCAAATGGG - Intronic
1063214182 10:3909319-3909341 CAGAAACAGCACCCTGAGAAAGG + Intergenic
1064215355 10:13395666-13395688 CAGTATCACCCCCATTATATAGG - Intergenic
1066349025 10:34619565-34619587 TACCACCACCACCATGAGATTGG + Intronic
1067786396 10:49252552-49252574 CAGAATCACAACCAGGAAACGGG + Intergenic
1069312105 10:67051130-67051152 CAGAATCTCCACTATGATTTTGG - Intronic
1072762751 10:98071104-98071126 CAGCATCACCACCAGTATATAGG + Intergenic
1075048808 10:119166529-119166551 CAGAAACAAAACCCTGAGATAGG - Intergenic
1077945377 11:6891751-6891773 AAGTATGACCACCATGAGGTGGG + Exonic
1079259415 11:18863993-18864015 CAGAATCAGCACCACTAGACAGG + Intergenic
1080684923 11:34507331-34507353 CAGAACAACCACTCTGAGATAGG + Intronic
1083097177 11:60263590-60263612 CAGGATCAGCACCAAGAGCTTGG + Intergenic
1087584238 11:100098008-100098030 CAGAATTACCAAGATGAGCTAGG + Intronic
1088064703 11:105702328-105702350 CAGAATCATCACAATGACTTGGG - Intronic
1088329141 11:108632296-108632318 CAGATGCACCCCCATGAAATAGG + Intergenic
1088975483 11:114812717-114812739 CAGAAGCAGCACAATGTGATTGG - Intergenic
1093230561 12:16537656-16537678 CAGACTCAACACCATGTGAAAGG + Intronic
1093348522 12:18069486-18069508 CAGAATCAGAACCGGGAGATTGG + Intergenic
1094539830 12:31353892-31353914 CAGAATCTCCACAATGAGAACGG - Intergenic
1095094943 12:38141879-38141901 CAGAAACACCATCACGAGCTTGG + Intergenic
1095297434 12:40542908-40542930 CAGAATGAGCATTATGAGATTGG + Intronic
1095744899 12:45647096-45647118 CAGAATCAAGCCCATGAGTTAGG - Intergenic
1097420951 12:59378822-59378844 CATGATCCCCACCATGACATGGG - Intergenic
1098572833 12:72008377-72008399 CAGAATCAGAATCCTGAGATGGG + Intronic
1099185720 12:79513791-79513813 CAGAATAACAACCATCAGAAAGG - Intergenic
1099391278 12:82082405-82082427 CAGGCTCACTTCCATGAGATGGG - Intergenic
1099633551 12:85181742-85181764 CAGATTCCTCACAATGAGATAGG - Intronic
1099845454 12:88022898-88022920 AAGAATCAACACCATGAAAATGG + Intronic
1100476348 12:94939150-94939172 CATAATGACCAGCATGAGCTGGG - Intronic
1100674125 12:96847654-96847676 AAGAAGCACCTCCATGAGACAGG - Intronic
1100793566 12:98156636-98156658 CATAATCACTGCCATCAGATGGG - Intergenic
1101300421 12:103474064-103474086 CTGAAAAACCACCATGGGATGGG - Intronic
1103841310 12:123867510-123867532 CACTATCACATCCATGAGATAGG - Exonic
1105992338 13:25635061-25635083 CAGTGTCAGCACCATGAGTTAGG + Intronic
1106435380 13:29719213-29719235 CAGTATCACAACCAGGATATTGG + Intergenic
1109405079 13:61887194-61887216 CAGAAGCATCACCAAGAGAGTGG + Intergenic
1110385147 13:74902060-74902082 CATAATCACCCCCATGAAATAGG - Intergenic
1112156905 13:96827543-96827565 CAGATTCAGAACCATAAGATAGG + Intronic
1118474447 14:66103529-66103551 CAGCATCAACACCAAAAGATGGG + Intergenic
1121030598 14:90655234-90655256 CAGAATCACCAGAGTGGGATTGG - Intronic
1121616077 14:95314705-95314727 AAAAATCCACACCATGAGATAGG + Intronic
1123431802 15:20224156-20224178 CACATTCACTACCATGAGAATGG - Intergenic
1127487915 15:59436671-59436693 CAGTGTCATCACCATGACATAGG + Intronic
1128741746 15:70088762-70088784 CAGAATTACCAATATGAGAAAGG + Intronic
1129318950 15:74763186-74763208 CAGCAGCTCCACCATCAGATGGG + Intergenic
1135693528 16:24565733-24565755 CATAATCACCACCAGGATAAAGG + Intronic
1138264531 16:55651058-55651080 CAGGGACACCACCATGAGGTGGG + Intergenic
1138795506 16:59963428-59963450 GAGAATCACTAGCAGGAGATGGG + Intergenic
1203114444 16_KI270728v1_random:1475503-1475525 CACATTCACTACCATGAGAATGG + Intergenic
1146452420 17:32985335-32985357 CAGAATCACCACCAAGGGCCAGG + Intronic
1148800474 17:50221866-50221888 CAGAACCAGGACCAGGAGATAGG - Intergenic
1148827112 17:50401916-50401938 CAGAATCACAACATAGAGATTGG - Intergenic
1149170005 17:53798171-53798193 CAGGATCATCACCATAACATTGG - Intergenic
1150663435 17:67107236-67107258 CAGAATCATCAACATGCTATTGG - Exonic
1152898389 17:82926291-82926313 CAGACCCCACACCATGAGATAGG - Intronic
1156776444 18:40794610-40794632 AAGAATCAACACCATGAAAATGG + Intergenic
1158972094 18:62678038-62678060 CAGAATCACCAGCATCACCTGGG - Intergenic
1160288809 18:77571714-77571736 CAGAATATCCAACTTGAGATGGG + Intergenic
925915754 2:8604450-8604472 TAGCATCACCACCAGGAGACAGG - Intergenic
928476414 2:31631856-31631878 CAGAATCAGAACAAGGAGATTGG + Intergenic
928620248 2:33081662-33081684 CAATATCAGCACCATGAGTTTGG - Intronic
928776810 2:34775200-34775222 CACAATCATCAATATGAGATTGG - Intergenic
933102945 2:78282980-78283002 CTTATTCACCACCATGAGAACGG - Intergenic
933214516 2:79613874-79613896 CAGTATTGGCACCATGAGATTGG - Intronic
935053501 2:99544432-99544454 CATACCCACCCCCATGAGATGGG - Intergenic
935071518 2:99698440-99698462 CAGAATCAACACCCTGGGATTGG - Intronic
935496916 2:103793424-103793446 CTTATTCACCACCATGAGAACGG + Intergenic
937299309 2:120829512-120829534 CATTATCACCACCTAGAGATGGG - Intronic
944849283 2:203701207-203701229 AAGAATCAGTACCATGAGATTGG + Intergenic
1169183655 20:3593416-3593438 CACAAACACCCCTATGAGATAGG + Intronic
1169341199 20:4797746-4797768 GAGAATCTCCCCCATGAGACTGG + Intronic
1170019023 20:11815126-11815148 CACCATAACCACCCTGAGATAGG + Intergenic
1170983657 20:21238692-21238714 CAGAATAAACACCATGAAATTGG - Intronic
1171234379 20:23512497-23512519 CAGAATCATCACCAGGTGACAGG + Intergenic
1174162102 20:48558736-48558758 CAGAGTCACCCTCATGGGATTGG - Intergenic
1174697633 20:52576446-52576468 AAGCATCACCACCAGGAGCTGGG - Intergenic
1174926081 20:54761516-54761538 CAGTATCACAACCAGGATATTGG - Intergenic
1175961732 20:62640863-62640885 CAGCATCATCACCAGAAGATGGG + Exonic
1176212933 20:63934040-63934062 CACAATCACCACCGTGAGAATGG - Exonic
949680990 3:6514184-6514206 CTGTAACACCACCATGAGGTTGG - Intergenic
952730228 3:36630831-36630853 GAGAACCACCATCATGACATGGG + Intergenic
953744630 3:45564862-45564884 CAGAGCCACAACCATCAGATGGG - Intronic
954766835 3:52925406-52925428 CAGACTCAGCACCATAAGACAGG + Intronic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
956711998 3:72047310-72047332 CAGAATCAACGCCATGAGTAGGG - Intergenic
958177626 3:90016713-90016735 AGGAAACACCATCATGAGATAGG + Intergenic
960247615 3:115416849-115416871 CACGTTCTCCACCATGAGATAGG - Intergenic
964395572 3:156242250-156242272 CAGAAGCACCAGCAAGAGAATGG - Intronic
967264693 3:187680170-187680192 CTGAGTCACCAACATGAGTTTGG + Intergenic
969870782 4:10103378-10103400 CAGAAATGCCACCATGAGGTTGG - Intronic
970046420 4:11859562-11859584 GAGACTTACTACCATGAGATAGG - Intergenic
970920221 4:21385302-21385324 CAGAACCACCAGCAGGAGGTGGG + Intronic
972319687 4:37962126-37962148 CAGAATCAGCTCCAAGATATGGG - Intronic
972403439 4:38725766-38725788 CTTATTCACCACCATGAGAATGG + Intergenic
972573868 4:40334091-40334113 CACAATCAACACAATGGGATAGG + Intergenic
973542576 4:51949096-51949118 AAGAATCACTACCATGAAAATGG - Intergenic
974756990 4:66222437-66222459 CATAATCAACAACTTGAGATAGG - Intergenic
975139777 4:70907199-70907221 CAAAATCACCAACTTGAGGTTGG + Intronic
978480518 4:109184933-109184955 CAGAATCAGGATCAAGAGATGGG - Intronic
978592760 4:110343749-110343771 AAGAATTACCACCCTGATATTGG - Intergenic
979734621 4:124067329-124067351 GAGAATCACCCTCATGTGATAGG - Intergenic
980017221 4:127663990-127664012 CAGTATCACAATCATGATATGGG + Intronic
983667048 4:170194085-170194107 CAGAATCAGAACAAGGAGATTGG - Intergenic
985012547 4:185599204-185599226 CAGAAGCACGGCCATGCGATAGG + Intronic
985083999 4:186294404-186294426 CAGAATGACTCCCATGAGCTTGG + Intergenic
986958758 5:13188764-13188786 CAGAAAGCCCACCATGAGAATGG - Intergenic
990683620 5:58274628-58274650 CAGAATCACTACCTAGAAATAGG + Intergenic
990846203 5:60142562-60142584 CAGAAACACCAGCATGAGCCAGG + Intronic
990925384 5:61015824-61015846 CATAATCACCACCATAAGACAGG - Intronic
991049044 5:62253164-62253186 CACATTCACTACCATGAGAATGG - Intergenic
991465679 5:66909826-66909848 CTTATTCACCACCATGAGAATGG - Intronic
993885373 5:93409608-93409630 CAGTATCACGACCAGGAGTTTGG + Intergenic
995194782 5:109352562-109352584 CAGAAAGAACATCATGAGATAGG - Intronic
1001686827 5:173599605-173599627 TAGAATCAGCACCATGTGACAGG - Intergenic
1006946047 6:37785141-37785163 CTGAATAACCACCAGGAGAGAGG + Intergenic
1008055899 6:46945930-46945952 CGTATTCACCACCATGAGAACGG + Intronic
1008095378 6:47334515-47334537 CTGAGTCACCACCATGTAATAGG - Intergenic
1008643271 6:53486497-53486519 CAGTATCACAACCAAGATATTGG + Intergenic
1010190998 6:73196385-73196407 CAGAAACACCACCAGGAAGTTGG + Exonic
1011648626 6:89484716-89484738 CAGAATACCCATAATGAGATTGG + Intronic
1013189275 6:107788632-107788654 CAGCTTCACCCCCATGAGATGGG - Intronic
1015487193 6:133786355-133786377 CAGATTCACAACCAAGAGGTGGG + Intergenic
1020068702 7:5211105-5211127 CAGAATCAACACGAGAAGATAGG + Intronic
1023626207 7:42117533-42117555 CAGAATCGCACCCATCAGATGGG - Intronic
1023686917 7:42745579-42745601 CAGAAGCATCATCATGAGCTGGG - Intergenic
1027928594 7:84500473-84500495 CATATTCACTACCATGAGAATGG + Intergenic
1028664795 7:93329051-93329073 CAGAATCTCCAGAATGAAATTGG + Intronic
1030100626 7:105941947-105941969 AAGAAGCAACACCAGGAGATGGG + Intronic
1033424982 7:141236029-141236051 CTGGATCACCAGCAAGAGATGGG + Intronic
1033681480 7:143600149-143600171 CAGAATCACCACCATGAGATAGG + Intergenic
1033703412 7:143861664-143861686 CAGAATCACCACCATGAGATAGG - Intronic
1034471927 7:151259495-151259517 CAGAACCTCCAACATGTGATGGG + Intronic
1034673638 7:152875954-152875976 CAGAATCAACATCATGAAAATGG - Intergenic
1037117152 8:15240523-15240545 CTGATTCACTACCATGAGAAGGG - Intergenic
1037570967 8:20157435-20157457 CAGAATCACAACATGGAGATTGG + Intronic
1041423951 8:57699639-57699661 AAGAATCAACACCATGAAAATGG + Intergenic
1042369137 8:67970998-67971020 CAAAAGCAACACCATGAAATGGG - Intronic
1045201074 8:99982086-99982108 CAGACTCATCACAATGAGAATGG + Exonic
1047443909 8:124902808-124902830 CAGAATCAGAACCTGGAGATTGG - Intergenic
1055852921 9:80653750-80653772 CAGAATCAATACCATGAAAATGG - Intergenic
1059363497 9:113766880-113766902 CTTATTCACCACCATGAGAATGG - Intergenic
1060325415 9:122609863-122609885 CAGAAGCACCACCAGGAGTCTGG + Intergenic
1060331565 9:122675857-122675879 CAGAATCACCACAGTGAGATGGG - Exonic
1060371118 9:123072582-123072604 CAGAATCACCACTGTGGGTTAGG + Intronic
1060493066 9:124099006-124099028 AGGAATCACCACCCTGAGACTGG + Intergenic
1062387858 9:136321381-136321403 AAGAATCAACACCATGAAAATGG - Intergenic
1062466832 9:136685315-136685337 CAGAATCTCCAAGCTGAGATGGG + Intronic
1190744335 X:53312660-53312682 CACAACCATCACAATGAGATGGG + Intronic
1196936062 X:120732245-120732267 CAGTATCACAACCAGGATATTGG - Intergenic
1198671733 X:139088440-139088462 CAGAAGCCCCACCATAAAATTGG - Intronic
1201604220 Y:15767514-15767536 CTTATTCACCACCATAAGATTGG + Intergenic